Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Homo sapiens
Genetic Insert: Tau (2N4R - I277P/I308P)
Vector Backbone Description: Backbone Size:3256; Vector Backbone:pT7II; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:41791447
Proper citation: RRID:Addgene_249557 Copy
Species: Homo sapiens
Genetic Insert: Tau (dGAE C322A)
Vector Backbone Description: Backbone Size:3256; Vector Backbone:pT7II; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:41791447
Proper citation: RRID:Addgene_249559 Copy
Species: Homo sapiens
Genetic Insert: tdiRFP
Vector Backbone Description: Backbone Size:2818; Vector Backbone:piggyBac; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:39990305
Comments: Please visit https://doi.org/10.1101/2025.02.04.636331 for bioRxiv preprint.
The depositor confirms that discrepancies between the depositor's sequence and Addgene's sequences have no functional consequences. Addgene NGS finds a 31 bp deletion in 7x TCF/LEF, and R123Q in tdIRFP (Twist 1) compared to the depositor reference sequence.
Proper citation: RRID:Addgene_249713 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: SMK1 Mitogen-activated Protein Kinase
Vector Backbone Description: Backbone Marker:Novagen; Backbone Size:5420; Vector Backbone:pET-DUET; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:28223369
Proper citation: RRID:Addgene_248909 Copy
Species: Synthetic
Genetic Insert: pGEX-GST-L3HP-1
Vector Backbone Description: Vector Backbone:pGEX; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:41481455
Proper citation: RRID:Addgene_248590 Copy
Species: Synthetic
Genetic Insert: pGEX-GST-D3LU-2
Vector Backbone Description: Vector Backbone:pGEX; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:41481455
Proper citation: RRID:Addgene_248591 Copy
Species: Homo sapiens
Genetic Insert: TCTA-P2 3'UTR
Vector Backbone Description: Vector Backbone:pmirGLO Dual-Luciferase miRNA Target Expression Vector; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:41533515
Proper citation: RRID:Addgene_236321 Copy
Species: Homo sapiens
Genetic Insert: C4orf19-P2 3'UTR
Vector Backbone Description: Vector Backbone:pmirGLO Dual-Luciferase miRNA Target Expression Vector; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:41533515
Proper citation: RRID:Addgene_236323 Copy
Species: Homo sapiens
Genetic Insert: DDR1-P2 3'UTR
Vector Backbone Description: Vector Backbone:pmirGLO Dual-Luciferase miRNA Target Expression Vector; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:41533515
Proper citation: RRID:Addgene_236328 Copy
Species: Homo sapiens
Genetic Insert: C6orf89-P2 3'UTR
Vector Backbone Description: Vector Backbone:pmirGLO Dual-Luciferase miRNA Target Expression Vector; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:41533515
Proper citation: RRID:Addgene_236325 Copy
Species: Homo sapiens
Genetic Insert: DDR1-P1 3'UTR
Vector Backbone Description: Vector Backbone:pmirGLO Dual-Luciferase miRNA Target Expression Vector; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:41533515
Proper citation: RRID:Addgene_236327 Copy
Species: Homo sapiens
Genetic Insert: C6orf89-P3 3'UTR
Vector Backbone Description: Vector Backbone:pmirGLO Dual-Luciferase miRNA Target Expression Vector; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:41533515
Proper citation: RRID:Addgene_236326 Copy
Species: Homo sapiens
Genetic Insert: non-targeting human sgRNA guides
Vector Backbone Description: Backbone Marker:Addgene; Backbone Size:9289; Vector Backbone:px458; Vector Types:CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:37573449
Proper citation: RRID:Addgene_206924 Copy
Species: Homo sapiens
Genetic Insert: sgRNA targeting IF1 (ATPase inhibitory factor 1)
Vector Backbone Description: Backbone Marker:Addgene; Backbone Size:9289; Vector Backbone:px458; Vector Types:CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:37573449
Comments: gRNA sequence (gcagtccgagaatgtcgaccg) differs from that listed in the original publication.
Proper citation: RRID:Addgene_206923 Copy
Species: Homo sapiens
Genetic Insert: PMF1-P1 3'UTR
Vector Backbone Description: Vector Backbone:pmirGLO Dual-Luciferase miRNA Target Expression Vector; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:41533515
Proper citation: RRID:Addgene_236310 Copy
Species: Homo sapiens
Genetic Insert: PTK6-P1 3'UTR
Vector Backbone Description: Vector Backbone:pmirGLO Dual-Luciferase miRNA Target Expression Vector; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:41533515
Proper citation: RRID:Addgene_236312 Copy
Species: Homo sapiens
Genetic Insert: ITGB6-P1 3'UTR
Vector Backbone Description: Vector Backbone:pmirGLO Dual-Luciferase miRNA Target Expression Vector; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:41533515
Proper citation: RRID:Addgene_236031 Copy
Species: Homo sapiens
Genetic Insert: HRH1-P2 3'UTR
Vector Backbone Description: Vector Backbone:pmirGLO Dual-Luciferase miRNA Target Expression Vector; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:41533515
Proper citation: RRID:Addgene_236030 Copy
Species: Homo sapiens
Genetic Insert: PTK6-P3 3'UTR
Vector Backbone Description: Vector Backbone:pmirGLO Dual-Luciferase miRNA Target Expression Vector; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:41533515
Proper citation: RRID:Addgene_236314 Copy
Species: Homo sapiens
Genetic Insert: RPS6KA3-P3 3'UTR
Vector Backbone Description: Vector Backbone:pmirGLO Dual-Luciferase miRNA Target Expression Vector; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:41533515
Proper citation: RRID:Addgene_236316 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within RRID that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
