Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search

On page 486 showing 9701 ~ 9720 out of 740,584 results
Snippet view Table view Download Top 1000 Results
Click the to add this resource to a Collection

http://www.addgene.org/249557

Species: Homo sapiens
Genetic Insert: Tau (2N4R - I277P/I308P)
Vector Backbone Description: Backbone Size:3256; Vector Backbone:pT7II; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:41791447

Proper citation: RRID:Addgene_249557 Copy   


  • RRID:Addgene_249559

http://www.addgene.org/249559

Species: Homo sapiens
Genetic Insert: Tau (dGAE C322A)
Vector Backbone Description: Backbone Size:3256; Vector Backbone:pT7II; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:41791447

Proper citation: RRID:Addgene_249559 Copy   


  • RRID:Addgene_249713

    This resource has 1+ mentions.

http://www.addgene.org/249713

Species: Homo sapiens
Genetic Insert: tdiRFP
Vector Backbone Description: Backbone Size:2818; Vector Backbone:piggyBac; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:39990305
Comments: Please visit https://doi.org/10.1101/2025.02.04.636331 for bioRxiv preprint. The depositor confirms that discrepancies between the depositor's sequence and Addgene's sequences have no functional consequences. Addgene NGS finds a 31 bp deletion in 7x TCF/LEF, and R123Q in tdIRFP (Twist 1) compared to the depositor reference sequence.

Proper citation: RRID:Addgene_249713 Copy   


  • RRID:Addgene_248909

http://www.addgene.org/248909

Species: Saccharomyces cerevisiae
Genetic Insert: SMK1 Mitogen-activated Protein Kinase
Vector Backbone Description: Backbone Marker:Novagen; Backbone Size:5420; Vector Backbone:pET-DUET; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:28223369

Proper citation: RRID:Addgene_248909 Copy   


http://www.addgene.org/248590

Species: Synthetic
Genetic Insert: pGEX-GST-L3HP-1
Vector Backbone Description: Vector Backbone:pGEX; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:41481455

Proper citation: RRID:Addgene_248590 Copy   


http://www.addgene.org/248591

Species: Synthetic
Genetic Insert: pGEX-GST-D3LU-2
Vector Backbone Description: Vector Backbone:pGEX; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:41481455

Proper citation: RRID:Addgene_248591 Copy   


  • RRID:Addgene_236321

    This resource has 1+ mentions.

http://www.addgene.org/236321

Species: Homo sapiens
Genetic Insert: TCTA-P2 3'UTR
Vector Backbone Description: Vector Backbone:pmirGLO Dual-Luciferase miRNA Target Expression Vector; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:41533515

Proper citation: RRID:Addgene_236321 Copy   


  • RRID:Addgene_236323

    This resource has 1+ mentions.

http://www.addgene.org/236323

Species: Homo sapiens
Genetic Insert: C4orf19-P2 3'UTR
Vector Backbone Description: Vector Backbone:pmirGLO Dual-Luciferase miRNA Target Expression Vector; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:41533515

Proper citation: RRID:Addgene_236323 Copy   


  • RRID:Addgene_236328

    This resource has 1+ mentions.

http://www.addgene.org/236328

Species: Homo sapiens
Genetic Insert: DDR1-P2 3'UTR
Vector Backbone Description: Vector Backbone:pmirGLO Dual-Luciferase miRNA Target Expression Vector; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:41533515

Proper citation: RRID:Addgene_236328 Copy   


  • RRID:Addgene_236325

    This resource has 1+ mentions.

http://www.addgene.org/236325

Species: Homo sapiens
Genetic Insert: C6orf89-P2 3'UTR
Vector Backbone Description: Vector Backbone:pmirGLO Dual-Luciferase miRNA Target Expression Vector; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:41533515

Proper citation: RRID:Addgene_236325 Copy   


  • RRID:Addgene_236327

    This resource has 1+ mentions.

http://www.addgene.org/236327

Species: Homo sapiens
Genetic Insert: DDR1-P1 3'UTR
Vector Backbone Description: Vector Backbone:pmirGLO Dual-Luciferase miRNA Target Expression Vector; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:41533515

Proper citation: RRID:Addgene_236327 Copy   


  • RRID:Addgene_236326

    This resource has 1+ mentions.

http://www.addgene.org/236326

Species: Homo sapiens
Genetic Insert: C6orf89-P3 3'UTR
Vector Backbone Description: Vector Backbone:pmirGLO Dual-Luciferase miRNA Target Expression Vector; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:41533515

Proper citation: RRID:Addgene_236326 Copy   


http://www.addgene.org/206924

Species: Homo sapiens
Genetic Insert: non-targeting human sgRNA guides
Vector Backbone Description: Backbone Marker:Addgene; Backbone Size:9289; Vector Backbone:px458; Vector Types:CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:37573449

Proper citation: RRID:Addgene_206924 Copy   


  • RRID:Addgene_206923

http://www.addgene.org/206923

Species: Homo sapiens
Genetic Insert: sgRNA targeting IF1 (ATPase inhibitory factor 1)
Vector Backbone Description: Backbone Marker:Addgene; Backbone Size:9289; Vector Backbone:px458; Vector Types:CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:37573449
Comments: gRNA sequence (gcagtccgagaatgtcgaccg) differs from that listed in the original publication.

Proper citation: RRID:Addgene_206923 Copy   


  • RRID:Addgene_236310

    This resource has 1+ mentions.

http://www.addgene.org/236310

Species: Homo sapiens
Genetic Insert: PMF1-P1 3'UTR
Vector Backbone Description: Vector Backbone:pmirGLO Dual-Luciferase miRNA Target Expression Vector; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:41533515

Proper citation: RRID:Addgene_236310 Copy   


  • RRID:Addgene_236312

    This resource has 1+ mentions.

http://www.addgene.org/236312

Species: Homo sapiens
Genetic Insert: PTK6-P1 3'UTR
Vector Backbone Description: Vector Backbone:pmirGLO Dual-Luciferase miRNA Target Expression Vector; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:41533515

Proper citation: RRID:Addgene_236312 Copy   


  • RRID:Addgene_236031

    This resource has 1+ mentions.

http://www.addgene.org/236031

Species: Homo sapiens
Genetic Insert: ITGB6-P1 3'UTR
Vector Backbone Description: Vector Backbone:pmirGLO Dual-Luciferase miRNA Target Expression Vector; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:41533515

Proper citation: RRID:Addgene_236031 Copy   


  • RRID:Addgene_236030

    This resource has 1+ mentions.

http://www.addgene.org/236030

Species: Homo sapiens
Genetic Insert: HRH1-P2 3'UTR
Vector Backbone Description: Vector Backbone:pmirGLO Dual-Luciferase miRNA Target Expression Vector; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:41533515

Proper citation: RRID:Addgene_236030 Copy   


  • RRID:Addgene_236314

    This resource has 1+ mentions.

http://www.addgene.org/236314

Species: Homo sapiens
Genetic Insert: PTK6-P3 3'UTR
Vector Backbone Description: Vector Backbone:pmirGLO Dual-Luciferase miRNA Target Expression Vector; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:41533515

Proper citation: RRID:Addgene_236314 Copy   


  • RRID:Addgene_236316

    This resource has 1+ mentions.

http://www.addgene.org/236316

Species: Homo sapiens
Genetic Insert: RPS6KA3-P3 3'UTR
Vector Backbone Description: Vector Backbone:pmirGLO Dual-Luciferase miRNA Target Expression Vector; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:41533515

Proper citation: RRID:Addgene_236316 Copy   



Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
  1. RRID Portal Resources

    Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Save Your Search

    You can save any searches you perform for quick access to later from here.

  6. Query Expansion

    We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.

  7. Collections

    If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  8. Sources

    Here are the sources that were queried against in your search that you can investigate further.

  9. Categories

    Here are the categories present within RRID that you can filter your data on

  10. Subcategories

    Here are the subcategories present within this category that you can filter your data on

  11. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

X