Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
| Plasmid Name | Proper Citation | Insert Name | Organism | Bacterial Resistance | Defining Citation |
Comments |
||||
|---|---|---|---|---|---|---|---|---|---|---|
|
pT7II-2N4Rtau I277P/I308P Resource Report Resource Website |
RRID:Addgene_249557 | Tau (2N4R - I277P/I308P) | Homo sapiens | Ampicillin | PMID:41791447 | Backbone Size:3256; Vector Backbone:pT7II; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | 2026-08-29 01:26:03 | 0 | ||
|
pT7II-dGAE C322A Resource Report Resource Website |
RRID:Addgene_249559 | Tau (dGAE C322A) | Homo sapiens | Ampicillin | PMID:41791447 | Backbone Size:3256; Vector Backbone:pT7II; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | 2026-08-29 01:26:03 | 0 | ||
|
pPig_8X-TOPFLash-tdIRFP_Puro Resource Report Resource Website 1+ mentions |
RRID:Addgene_249713 | tdiRFP | Homo sapiens | Ampicillin | PMID:39990305 | Please visit https://doi.org/10.1101/2025.02.04.636331 for bioRxiv preprint. The depositor confirms that discrepancies between the depositor's sequence and Addgene's sequences have no functional consequences. Addgene NGS finds a 31 bp deletion in 7x TCF/LEF, and R123Q in tdIRFP (Twist 1) compared to the depositor reference sequence. | Backbone Size:2818; Vector Backbone:piggyBac; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-29 01:26:03 | 1 | |
|
pJTB115 Resource Report Resource Website |
RRID:Addgene_248909 | SMK1 Mitogen-activated Protein Kinase | Saccharomyces cerevisiae | Ampicillin | PMID:28223369 | Backbone Marker:Novagen; Backbone Size:5420; Vector Backbone:pET-DUET; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | NdeI and NcoI sites were removed for cloning purposes | 2026-08-29 01:26:03 | 0 | |
|
GST-tag HOIP binding E2 variant L3HP-1 Resource Report Resource Website 1+ mentions |
RRID:Addgene_248590 | pGEX-GST-L3HP-1 | Synthetic | Ampicillin | PMID:41481455 | Vector Backbone:pGEX; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | 2026-08-29 01:26:02 | 1 | ||
|
GST-tag LUBAC binding E2 variant D3LU-2 Resource Report Resource Website 1+ mentions |
RRID:Addgene_248591 | pGEX-GST-D3LU-2 | Synthetic | Ampicillin | PMID:41481455 | Vector Backbone:pGEX; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | 2026-08-29 01:26:02 | 1 | ||
|
TCTA-P2 Resource Report Resource Website 1+ mentions |
RRID:Addgene_236321 | TCTA-P2 3'UTR | Homo sapiens | Ampicillin | PMID:41533515 | Vector Backbone:pmirGLO Dual-Luciferase miRNA Target Expression Vector; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-29 01:26:05 | 1 | ||
|
C4orf19-P2 Resource Report Resource Website 1+ mentions |
RRID:Addgene_236323 | C4orf19-P2 3'UTR | Homo sapiens | Ampicillin | PMID:41533515 | Vector Backbone:pmirGLO Dual-Luciferase miRNA Target Expression Vector; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-29 01:26:05 | 1 | ||
|
DDR1-P2 Resource Report Resource Website 1+ mentions |
RRID:Addgene_236328 | DDR1-P2 3'UTR | Homo sapiens | Ampicillin | PMID:41533515 | Vector Backbone:pmirGLO Dual-Luciferase miRNA Target Expression Vector; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-29 01:26:05 | 1 | ||
|
C6orf89-P2 Resource Report Resource Website 1+ mentions |
RRID:Addgene_236325 | C6orf89-P2 3'UTR | Homo sapiens | Ampicillin | PMID:41533515 | Vector Backbone:pmirGLO Dual-Luciferase miRNA Target Expression Vector; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-29 01:26:05 | 1 | ||
|
DDR1-P1 Resource Report Resource Website 1+ mentions |
RRID:Addgene_236327 | DDR1-P1 3'UTR | Homo sapiens | Ampicillin | PMID:41533515 | Vector Backbone:pmirGLO Dual-Luciferase miRNA Target Expression Vector; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-29 01:26:05 | 1 | ||
|
C6orf89-P3 Resource Report Resource Website 1+ mentions |
RRID:Addgene_236326 | C6orf89-P3 3'UTR | Homo sapiens | Ampicillin | PMID:41533515 | Vector Backbone:pmirGLO Dual-Luciferase miRNA Target Expression Vector; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-29 01:26:05 | 1 | ||
|
px-458-sgRNA-scramble Resource Report Resource Website |
RRID:Addgene_206924 | non-targeting human sgRNA guides | Homo sapiens | Ampicillin | PMID:37573449 | Backbone Marker:Addgene; Backbone Size:9289; Vector Backbone:px458; Vector Types:CRISPR; Bacterial Resistance:Ampicillin | 2026-08-29 01:26:04 | 0 | ||
|
px-458-sgRNA-IF1 Resource Report Resource Website |
RRID:Addgene_206923 | sgRNA targeting IF1 (ATPase inhibitory factor 1) | Homo sapiens | Ampicillin | PMID:37573449 | gRNA sequence (gcagtccgagaatgtcgaccg) differs from that listed in the original publication. | Backbone Marker:Addgene; Backbone Size:9289; Vector Backbone:px458; Vector Types:CRISPR; Bacterial Resistance:Ampicillin | 2026-08-29 01:26:04 | 0 | |
|
PMF1-P1 Resource Report Resource Website 1+ mentions |
RRID:Addgene_236310 | PMF1-P1 3'UTR | Homo sapiens | Ampicillin | PMID:41533515 | Vector Backbone:pmirGLO Dual-Luciferase miRNA Target Expression Vector; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-29 01:26:04 | 1 | ||
|
PTK6-P1 Resource Report Resource Website 1+ mentions |
RRID:Addgene_236312 | PTK6-P1 3'UTR | Homo sapiens | Ampicillin | PMID:41533515 | Vector Backbone:pmirGLO Dual-Luciferase miRNA Target Expression Vector; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-29 01:26:04 | 1 | ||
|
ITGB6-P1 Resource Report Resource Website 1+ mentions |
RRID:Addgene_236031 | ITGB6-P1 3'UTR | Homo sapiens | Ampicillin | PMID:41533515 | Vector Backbone:pmirGLO Dual-Luciferase miRNA Target Expression Vector; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-29 01:26:04 | 1 | ||
|
HRH1-P2 Resource Report Resource Website 1+ mentions |
RRID:Addgene_236030 | HRH1-P2 3'UTR | Homo sapiens | Ampicillin | PMID:41533515 | Vector Backbone:pmirGLO Dual-Luciferase miRNA Target Expression Vector; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-29 01:26:04 | 1 | ||
|
PTK6-P3 Resource Report Resource Website 1+ mentions |
RRID:Addgene_236314 | PTK6-P3 3'UTR | Homo sapiens | Ampicillin | PMID:41533515 | Vector Backbone:pmirGLO Dual-Luciferase miRNA Target Expression Vector; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-29 01:26:04 | 1 | ||
|
RPS6KA3-P3 Resource Report Resource Website 1+ mentions |
RRID:Addgene_236316 | RPS6KA3-P3 3'UTR | Homo sapiens | Ampicillin | PMID:41533515 | Vector Backbone:pmirGLO Dual-Luciferase miRNA Target Expression Vector; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-29 01:26:04 | 1 |
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.