Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Preparing word cloud

×

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search
Reset search
Filter by records added date

See new records

Options

Current Facets and Filters

  • Issues Status:no known issues (facet)

Facets

Recent searches

Snippet view Table view

Can't find the RRID you're searching for? X
Click the to add this resource to a Collection

740,584 Results - per page

Show More Columns | Download Top 1000 Results

Plasmid Name

Sort Ascending

Sort Descending

 Proper Citation

Sort Ascending

Sort Descending

 Insert Name

Sort Ascending

Sort Descending

 Organism

Sort Ascending

Sort Descending

 Bacterial Resistance

Sort Ascending

Sort Descending

 Defining Citation

Sort Ascending

Sort Descending

 Comments
Vector Backbone Description
Relevant Mutation
Record Last Update

Sort Ascending

Sort Descending

 Mentions Count

Sort Ascending

Sort Descending
pT7II-2N4Rtau I277P/I308P
 
Resource Report
Resource Website 		RRID:Addgene_249557 Tau (2N4R - I277P/I308P) Homo sapiens Ampicillin PMID:41791447 Backbone Size:3256; Vector Backbone:pT7II; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin 2026-08-29 01:26:03 0
pT7II-dGAE C322A
 
Resource Report
Resource Website 		RRID:Addgene_249559 Tau (dGAE C322A) Homo sapiens Ampicillin PMID:41791447 Backbone Size:3256; Vector Backbone:pT7II; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin 2026-08-29 01:26:03 0
pPig_8X-TOPFLash-tdIRFP_Puro
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_249713 tdiRFP Homo sapiens Ampicillin PMID:39990305 Please visit https://doi.org/10.1101/2025.02.04.636331 for bioRxiv preprint. The depositor confirms that discrepancies between the depositor's sequence and Addgene's sequences have no functional consequences. Addgene NGS finds a 31 bp deletion in 7x TCF/LEF, and R123Q in tdIRFP (Twist 1) compared to the depositor reference sequence. Backbone Size:2818; Vector Backbone:piggyBac; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-08-29 01:26:03 1
pJTB115
 
Resource Report
Resource Website 		RRID:Addgene_248909 SMK1 Mitogen-activated Protein Kinase Saccharomyces cerevisiae Ampicillin PMID:28223369 Backbone Marker:Novagen; Backbone Size:5420; Vector Backbone:pET-DUET; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin NdeI and NcoI sites were removed for cloning purposes 2026-08-29 01:26:03 0
GST-tag HOIP binding E2 variant L3HP-1
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_248590 pGEX-GST-L3HP-1 Synthetic Ampicillin PMID:41481455 Vector Backbone:pGEX; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin 2026-08-29 01:26:02 1
GST-tag LUBAC binding E2 variant D3LU-2
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_248591 pGEX-GST-D3LU-2 Synthetic Ampicillin PMID:41481455 Vector Backbone:pGEX; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin 2026-08-29 01:26:02 1
TCTA-P2
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_236321 TCTA-P2 3'UTR Homo sapiens Ampicillin PMID:41533515 Vector Backbone:pmirGLO Dual-Luciferase miRNA Target Expression Vector; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-08-29 01:26:05 1
C4orf19-P2
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_236323 C4orf19-P2 3'UTR Homo sapiens Ampicillin PMID:41533515 Vector Backbone:pmirGLO Dual-Luciferase miRNA Target Expression Vector; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-08-29 01:26:05 1
DDR1-P2
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_236328 DDR1-P2 3'UTR Homo sapiens Ampicillin PMID:41533515 Vector Backbone:pmirGLO Dual-Luciferase miRNA Target Expression Vector; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-08-29 01:26:05 1
C6orf89-P2
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_236325 C6orf89-P2 3'UTR Homo sapiens Ampicillin PMID:41533515 Vector Backbone:pmirGLO Dual-Luciferase miRNA Target Expression Vector; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-08-29 01:26:05 1
DDR1-P1
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_236327 DDR1-P1 3'UTR Homo sapiens Ampicillin PMID:41533515 Vector Backbone:pmirGLO Dual-Luciferase miRNA Target Expression Vector; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-08-29 01:26:05 1
C6orf89-P3
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_236326 C6orf89-P3 3'UTR Homo sapiens Ampicillin PMID:41533515 Vector Backbone:pmirGLO Dual-Luciferase miRNA Target Expression Vector; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-08-29 01:26:05 1
px-458-sgRNA-scramble
 
Resource Report
Resource Website 		RRID:Addgene_206924 non-targeting human sgRNA guides Homo sapiens Ampicillin PMID:37573449 Backbone Marker:Addgene; Backbone Size:9289; Vector Backbone:px458; Vector Types:CRISPR; Bacterial Resistance:Ampicillin 2026-08-29 01:26:04 0
px-458-sgRNA-IF1
 
Resource Report
Resource Website 		RRID:Addgene_206923 sgRNA targeting IF1 (ATPase inhibitory factor 1) Homo sapiens Ampicillin PMID:37573449 gRNA sequence (gcagtccgagaatgtcgaccg) differs from that listed in the original publication. Backbone Marker:Addgene; Backbone Size:9289; Vector Backbone:px458; Vector Types:CRISPR; Bacterial Resistance:Ampicillin 2026-08-29 01:26:04 0
PMF1-P1
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_236310 PMF1-P1 3'UTR Homo sapiens Ampicillin PMID:41533515 Vector Backbone:pmirGLO Dual-Luciferase miRNA Target Expression Vector; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-08-29 01:26:04 1
PTK6-P1
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_236312 PTK6-P1 3'UTR Homo sapiens Ampicillin PMID:41533515 Vector Backbone:pmirGLO Dual-Luciferase miRNA Target Expression Vector; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-08-29 01:26:04 1
ITGB6-P1
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_236031 ITGB6-P1 3'UTR Homo sapiens Ampicillin PMID:41533515 Vector Backbone:pmirGLO Dual-Luciferase miRNA Target Expression Vector; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-08-29 01:26:04 1
HRH1-P2
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_236030 HRH1-P2 3'UTR Homo sapiens Ampicillin PMID:41533515 Vector Backbone:pmirGLO Dual-Luciferase miRNA Target Expression Vector; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-08-29 01:26:04 1
PTK6-P3
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_236314 PTK6-P3 3'UTR Homo sapiens Ampicillin PMID:41533515 Vector Backbone:pmirGLO Dual-Luciferase miRNA Target Expression Vector; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-08-29 01:26:04 1
RPS6KA3-P3
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_236316 RPS6KA3-P3 3'UTR Homo sapiens Ampicillin PMID:41533515 Vector Backbone:pmirGLO Dual-Luciferase miRNA Target Expression Vector; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-08-29 01:26:04 1

Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
X

  1. RRID Portal Resources

    Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search

  5. Collections

    If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  6. Facets

    Here are the facets that you can filter the data by.

  7. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

About

Welcome to the Resource Identification Portal Community.

Please see Force11 for more detailed information

We thank the NIH for their support of the RRID portal Award# R24GM144308, U24DK097771, U24DA039832, HHSN276201700124P, 75N97021P00135

Recent News Entries

Contact Us

Our Information

rii-help *at* scicrunch.org

About SciCrunch | Privacy Policy | Terms of Service

SciCrunch