Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Vector Backbone Description: Backbone Marker:Structural Genomics Consortium; Vector Backbone:pFHMSP-LIC-N; Vector Types:Insect Expression, Baculovirus expression; Bacterial Resistance:Ampicillin
Comments: The pFHMSP-LIC N vector is a derivative of the pFastBac HT A vector (Invitrogen). Honeybee melittin signal sequence was introduced before His tag. It is a donor vector for generation of recombinant baculovirus by site-specific transposition into a baculovirus shuttle vector (bacmid) in E. coli host strain, DH10Bac. For use in Bac-to-Bac Baculovirus Expression System in insect cells for secreted protein expression. This vector adds a 26 amino acid N-terminal fusion tag containing 6X His followed by a TEV cleavage site.
Insertion of DNA sequence into the cloning/expression region is performed using BD-Biosciences Infusion enzyme mediated by directional recombination between complementary nucleotide DNA sequences at the ends of the insert (PCR product) and Nco1/HindIII linearized vector. Insertion of target sequence involves replacement of a SacB gene stuffer sequence, which provides for negative selection of the original plasmid on 5% sucrose.
http://www.sgc.utoronto.ca/SGC-WebPages/toronto-vectors.php
Proper citation: RRID:Addgene_26095 Copy
Species: Schmidtea mediterranea
Genetic Insert: Smed-elav2
Vector Backbone Description: Backbone Size:3000; Vector Backbone:pBluescript II SK(+); Vector Types:cloning; Bacterial Resistance:Ampicillin
Defining Citation: PMID:20844018
Proper citation: RRID:Addgene_26131 Copy
Species: Schmidtea mediterranea
Genetic Insert: Smed-elav1
Vector Backbone Description: Backbone Size:3000; Vector Backbone:pBluescript II SK(+); Vector Types:cloning; Bacterial Resistance:Ampicillin
Defining Citation: PMID:20844018
Proper citation: RRID:Addgene_26130 Copy
Genetic Insert: 23S ribosomal RNA fragment (modified) with G2553U mutation
Vector Backbone Description: Backbone Size:2876; Vector Backbone:modified pUC19; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:20673833
Proper citation: RRID:Addgene_26191 Copy
Vector Backbone Description: Backbone Size:5120; Vector Backbone:pBMTBX-1; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:20148414
Proper citation: RRID:Addgene_26072 Copy
Genetic Insert: phi80 integration helper plasmid pInt80-649
Vector Backbone Description: Backbone Size:0; Vector Backbone:derivative of helper plasmid pAH123; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Ampicillin
Defining Citation: PMID:20205762
Proper citation: RRID:Addgene_26187 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: Med7 aa102-205 for C-terminal tagging
Vector Backbone Description: Backbone Size:2852; Vector Backbone:pMLL-KA; Vector Types:Synthetic Biology, 2ab assembly vector; Bacterial Resistance:Ampicillin and Kanamycin
Comments: Note that this plasmid needs to be grown in both Kanamycin and Ampicillin
Proper citation: RRID:Addgene_26184 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: Med21 aa1-132 for N-terminal tagging
Vector Backbone Description: Backbone Size:2646; Vector Backbone:pMLL-CK; Vector Types:Synthetic Biology, 2ab assembly vector; Bacterial Resistance:Chloramphenicol and Kanamycin
Comments: Note that this plasmid must be grown in both Chloramphenicol and Kanamycin
Proper citation: RRID:Addgene_26183 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: Med21 aa1-132 for C-terminal tagging
Vector Backbone Description: Backbone Size:2852; Vector Backbone:pMLL-KA; Vector Types:Synthetic Biology, 2ab assembly vector; Bacterial Resistance:Ampicillin and Kanamycin
Comments: Note that this plasmid needs to be grown in both Kanamycin and Ampicillin
Proper citation: RRID:Addgene_26185 Copy
Vector Backbone Description: Backbone Size:4224; Vector Backbone:pBTBXh-4; Vector Types:Bacterial Expression; Bacterial Resistance:Tetracycline
Defining Citation: PMID:20148414
Comments: There is an extra G in the middle of the alignment between Addgene's quality control sequence and the author's sequence. This discrepancy is in a non-coding region and does affect function.
Proper citation: RRID:Addgene_26080 Copy
Species: E. coli
Genetic Insert: a loxP-flanked β-geo preceding the tetracycline transactivator tTA
Vector Backbone Description: Backbone Size:5100; Vector Backbone:pCA-HZ2; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:20634890
Proper citation: RRID:Addgene_26083 Copy
Species: E. coli
Genetic Insert: a loxP-flanked β-geo preceding the tetracycline transactivator tTA
Vector Backbone Description: Backbone Size:12000; Vector Backbone:pROSA26-PA targeting vector; Vector Types:Mouse Targeting; Bacterial Resistance:Ampicillin
Defining Citation: PMID:20634890
Comments: 6bp deletion in Addgene sequence compared to author sequence. The discrepancy is in the vector before the BGH terminator and is not likely to affect function.
Proper citation: RRID:Addgene_26082 Copy
Species: Homo sapiens
Genetic Insert: ATF4
Vector Backbone Description: Backbone Marker:Dr. Hongbin Shu; Vector Backbone:pRK5-A20 (TNFAIP3); Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19164757
Proper citation: RRID:Addgene_26118 Copy
Species: Homo sapiens
Genetic Insert: ATF4
Vector Backbone Description: Backbone Marker:Dr. Hongbin Shu; Vector Backbone:pRK5-A20 (TNFAIP3); Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19164757
Proper citation: RRID:Addgene_26114 Copy
Vector Backbone Description: Backbone Marker:SGC Oxford; Backbone Size:7218; Vector Backbone:pNIC-CH; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Comments: pET expression vector with C-terminal His6 tag. Includes sites for LIC cloning, and a “stuffer” fragment that includes the SacB gene, allowing negative selection on 5% sucrose. GenBank accession number: EF199843
Primers for LIC cloning:
Add the following 5’ extensions to the PCR primers:
Upstream: TTAAGAAGGAGATATACTATG (ATG-initiation codon)
Downstream: AATGGTGGTGATGATGGTGCGC
The purified PCR fragments are treated with T4 DNA polymerase and dGTP, then annealed to the treated vector. See supplemental document for more information.
Proper citation: RRID:Addgene_26117 Copy
Vector Backbone Description: Backbone Size:3845; Vector Backbone:pBTBXh-2; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:20148414
Comments: There is an extra G in the middle of the alignment between Addgene's quality control sequence and the author's sequence. This discrepancy is in a non-coding region and does affect function.
Proper citation: RRID:Addgene_26078 Copy
Vector Backbone Description: Backbone Size:3889; Vector Backbone:pBTBXh-1; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:20148414
Comments: There is an extra G in the middle of the alignment between Addgene's quality control sequence and the author's sequence. This discrepancy is in a non-coding region and does affect function.
Proper citation: RRID:Addgene_26077 Copy
Vector Backbone Description: Backbone Size:3691; Vector Backbone:pBTBXh-3; Vector Types:Bacterial Expression; Bacterial Resistance:Chloramphenicol
Defining Citation: PMID:20148414
Comments: There is an extra G in the middle of the alignment between Addgene's quality control sequence and the author's sequence. This discrepancy is in a non-coding region and does affect function.
Proper citation: RRID:Addgene_26079 Copy
Species: Homo sapiens
Genetic Insert: NOXA N1
Vector Backbone Description: Backbone Size:5000; Vector Backbone:pGL3; Vector Types:Mammalian Expression, Luciferase; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19164757
Proper citation: RRID:Addgene_26112 Copy
Vector Backbone Description: Backbone Size:4922; Vector Backbone:pBMTBX-3; Vector Types:Bacterial Expression; Bacterial Resistance:Chloramphenicol
Defining Citation: PMID:20148414
Proper citation: RRID:Addgene_26074 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within RRID that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
