Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
| Plasmid Name | Proper Citation | Insert Name | Organism | Bacterial Resistance | Defining Citation |
Comments |
||||
|---|---|---|---|---|---|---|---|---|---|---|
|
pFHMSP-LIC-N Resource Report Resource Website |
RRID:Addgene_26095 | Ampicillin | The pFHMSP-LIC N vector is a derivative of the pFastBac HT A vector (Invitrogen). Honeybee melittin signal sequence was introduced before His tag. It is a donor vector for generation of recombinant baculovirus by site-specific transposition into a baculovirus shuttle vector (bacmid) in E. coli host strain, DH10Bac. For use in Bac-to-Bac Baculovirus Expression System in insect cells for secreted protein expression. This vector adds a 26 amino acid N-terminal fusion tag containing 6X His followed by a TEV cleavage site. Insertion of DNA sequence into the cloning/expression region is performed using BD-Biosciences Infusion enzyme mediated by directional recombination between complementary nucleotide DNA sequences at the ends of the insert (PCR product) and Nco1/HindIII linearized vector. Insertion of target sequence involves replacement of a SacB gene stuffer sequence, which provides for negative selection of the original plasmid on 5% sucrose. http://www.sgc.utoronto.ca/SGC-WebPages/toronto-vectors.php | Backbone Marker:Structural Genomics Consortium; Vector Backbone:pFHMSP-LIC-N; Vector Types:Insect Expression, Baculovirus expression; Bacterial Resistance:Ampicillin | 2026-08-29 01:02:56 | 0 | ||||
|
pBS-elav-2 Resource Report Resource Website |
RRID:Addgene_26131 | Smed-elav2 | Schmidtea mediterranea | Ampicillin | PMID:20844018 | Backbone Size:3000; Vector Backbone:pBluescript II SK(+); Vector Types:cloning; Bacterial Resistance:Ampicillin | 2026-08-29 01:02:56 | 0 | ||
|
pBS-elav-1 Resource Report Resource Website 1+ mentions |
RRID:Addgene_26130 | Smed-elav1 | Schmidtea mediterranea | Ampicillin | PMID:20844018 | Backbone Size:3000; Vector Backbone:pBluescript II SK(+); Vector Types:cloning; Bacterial Resistance:Ampicillin | 2026-08-29 01:02:56 | 1 | ||
|
23SrRNA.RAV12(wt).2508-2580.GAAAC.G2553U Resource Report Resource Website |
RRID:Addgene_26191 | 23S ribosomal RNA fragment (modified) with G2553U mutation | Ampicillin | PMID:20673833 | Backbone Size:2876; Vector Backbone:modified pUC19; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | fragment 2508-2580 of E. coli rRNA, with nucleotides 2530-2534 replaced with GAAAC and an rA 3' to nucleotide 2580 plus G2553U mutation | 2026-08-29 01:02:59 | 0 | ||
|
pBMTBX-1 Resource Report Resource Website |
RRID:Addgene_26072 | Ampicillin | PMID:20148414 | Backbone Size:5120; Vector Backbone:pBMTBX-1; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | 2026-08-29 01:02:55 | 0 | ||||
|
J72008 bacterial strain with plasmid Resource Report Resource Website |
RRID:Addgene_26187 | phi80 integration helper plasmid pInt80-649 | Ampicillin | PMID:20205762 | Backbone Size:0; Vector Backbone:derivative of helper plasmid pAH123; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Ampicillin | 2026-08-29 01:02:58 | 0 | |||
|
pMLLKA-J72039 Resource Report Resource Website |
RRID:Addgene_26184 | Med7 aa102-205 for C-terminal tagging | Saccharomyces cerevisiae | Ampicillin and Kanamycin | Note that this plasmid needs to be grown in both Kanamycin and Ampicillin | Backbone Size:2852; Vector Backbone:pMLL-KA; Vector Types:Synthetic Biology, 2ab assembly vector; Bacterial Resistance:Ampicillin and Kanamycin | 2026-08-29 01:02:57 | 0 | ||
|
pMLLCK-J72038 Resource Report Resource Website |
RRID:Addgene_26183 | Med21 aa1-132 for N-terminal tagging | Saccharomyces cerevisiae | Chloramphenicol and Kanamycin | Note that this plasmid must be grown in both Chloramphenicol and Kanamycin | Backbone Size:2646; Vector Backbone:pMLL-CK; Vector Types:Synthetic Biology, 2ab assembly vector; Bacterial Resistance:Chloramphenicol and Kanamycin | 2026-08-29 01:02:57 | 0 | ||
|
pMLLKA-J72040 Resource Report Resource Website |
RRID:Addgene_26185 | Med21 aa1-132 for C-terminal tagging | Saccharomyces cerevisiae | Ampicillin and Kanamycin | Note that this plasmid needs to be grown in both Kanamycin and Ampicillin | Backbone Size:2852; Vector Backbone:pMLL-KA; Vector Types:Synthetic Biology, 2ab assembly vector; Bacterial Resistance:Ampicillin and Kanamycin | 2026-08-29 01:02:57 | 0 | ||
|
pBTBXh-4 Resource Report Resource Website |
RRID:Addgene_26080 | Tetracycline | PMID:20148414 | There is an extra G in the middle of the alignment between Addgene's quality control sequence and the author's sequence. This discrepancy is in a non-coding region and does affect function. | Backbone Size:4224; Vector Backbone:pBTBXh-4; Vector Types:Bacterial Expression; Bacterial Resistance:Tetracycline | 2026-08-29 01:02:55 | 0 | |||
|
pCA-ZtTA Resource Report Resource Website |
RRID:Addgene_26083 | a loxP-flanked β-geo preceding the tetracycline transactivator tTA | E. coli | Ampicillin | PMID:20634890 | Backbone Size:5100; Vector Backbone:pCA-HZ2; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-29 01:02:55 | 0 | ||
|
pROSA26-ZtTA Resource Report Resource Website |
RRID:Addgene_26082 | a loxP-flanked β-geo preceding the tetracycline transactivator tTA | E. coli | Ampicillin | PMID:20634890 | 6bp deletion in Addgene sequence compared to author sequence. The discrepancy is in the vector before the BGH terminator and is not likely to affect function. | Backbone Size:12000; Vector Backbone:pROSA26-PA targeting vector; Vector Types:Mouse Targeting; Bacterial Resistance:Ampicillin | 2026-08-29 01:02:55 | 0 | |
|
pRK-ATF4 1-275 Resource Report Resource Website 1+ mentions |
RRID:Addgene_26118 | ATF4 | Homo sapiens | Ampicillin | PMID:19164757 | Backbone Marker:Dr. Hongbin Shu; Vector Backbone:pRK5-A20 (TNFAIP3); Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | aa's 276-351 have been deleted | 2026-08-29 01:02:56 | 1 | |
|
pRK-ATF4 Resource Report Resource Website 10+ mentions |
RRID:Addgene_26114 | ATF4 | Homo sapiens | Ampicillin | PMID:19164757 | Backbone Marker:Dr. Hongbin Shu; Vector Backbone:pRK5-A20 (TNFAIP3); Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-29 01:02:56 | 19 | ||
|
pNIC-CH Resource Report Resource Website 1+ mentions |
RRID:Addgene_26117 | Kanamycin | pET expression vector with C-terminal His6 tag. Includes sites for LIC cloning, and a “stuffer” fragment that includes the SacB gene, allowing negative selection on 5% sucrose. GenBank accession number: EF199843 Primers for LIC cloning: Add the following 5’ extensions to the PCR primers: Upstream: TTAAGAAGGAGATATACTATG (ATG-initiation codon) Downstream: AATGGTGGTGATGATGGTGCGC The purified PCR fragments are treated with T4 DNA polymerase and dGTP, then annealed to the treated vector. See supplemental document for more information. | Backbone Marker:SGC Oxford; Backbone Size:7218; Vector Backbone:pNIC-CH; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin | 2026-08-29 01:02:56 | 7 | ||||
|
pBTBXh-2 Resource Report Resource Website |
RRID:Addgene_26078 | Kanamycin | PMID:20148414 | There is an extra G in the middle of the alignment between Addgene's quality control sequence and the author's sequence. This discrepancy is in a non-coding region and does affect function. | Backbone Size:3845; Vector Backbone:pBTBXh-2; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin | 2026-08-29 01:02:55 | 0 | |||
|
pBTBXh-1 Resource Report Resource Website |
RRID:Addgene_26077 | Ampicillin | PMID:20148414 | There is an extra G in the middle of the alignment between Addgene's quality control sequence and the author's sequence. This discrepancy is in a non-coding region and does affect function. | Backbone Size:3889; Vector Backbone:pBTBXh-1; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | 2026-08-29 01:02:55 | 0 | |||
|
pBTBXh-3 Resource Report Resource Website |
RRID:Addgene_26079 | Chloramphenicol | PMID:20148414 | There is an extra G in the middle of the alignment between Addgene's quality control sequence and the author's sequence. This discrepancy is in a non-coding region and does affect function. | Backbone Size:3691; Vector Backbone:pBTBXh-3; Vector Types:Bacterial Expression; Bacterial Resistance:Chloramphenicol | 2026-08-29 01:02:55 | 0 | |||
|
PGL3-NOXA-N1 Resource Report Resource Website 1+ mentions |
RRID:Addgene_26112 | NOXA N1 | Homo sapiens | Ampicillin | PMID:19164757 | Backbone Size:5000; Vector Backbone:pGL3; Vector Types:Mammalian Expression, Luciferase; Bacterial Resistance:Ampicillin | 2026-08-29 01:02:56 | 3 | ||
|
pBMTBX-3 Resource Report Resource Website |
RRID:Addgene_26074 | Chloramphenicol | PMID:20148414 | Backbone Size:4922; Vector Backbone:pBMTBX-3; Vector Types:Bacterial Expression; Bacterial Resistance:Chloramphenicol | 2026-08-29 01:02:55 | 0 |
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
