Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
| Plasmid Name | Proper Citation | Insert Name | Organism | Bacterial Resistance | Defining Citation |
Comments |
||||
|---|---|---|---|---|---|---|---|---|---|---|
|
pXL001 Resource Report Resource Website 1+ mentions |
RRID:Addgene_26122 | tTR-KRAB | trans-activator - KRAB | Ampicillin | PMID:22645348 | Backbone Size:7569; Vector Backbone:pSin-EF2-Nanog; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin | 2026-09-01 09:51:34 | 3 | ||
|
CMV::ratSyGCaMP2 Resource Report Resource Website 10+ mentions |
RRID:Addgene_26124 | Synaptophysin GCaMP2 | Rattus norvegicus | Kanamycin | PMID:19898484 | ORF frame 3 (624-2915): Rat SyGCaMP2. Our sequence with CMV-F shows a mutation S199T in Synaptophysin ORF. This change does not have any effect in localizing the construct to the synaptic vesicle and may be a result of a SNP. | Backbone Size:3957; Vector Backbone:pEGFP-N1 (Clontech); Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin | 2026-09-01 09:51:34 | 10 | |
|
pCA-mTmG Resource Report Resource Website 1+ mentions |
RRID:Addgene_26123 | Precursor mT/mG | Aquorea victoria | Ampicillin | Backbone Size:5000; Vector Backbone:pCA-HZ2; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-09-01 09:51:34 | 3 | |||
|
pSVE Grb2 myc 49L Resource Report Resource Website 1+ mentions |
RRID:Addgene_26085 | Grb2 P49L | Homo sapiens | Ampicillin | PMID:8479536 | mutagenesis performed using oligo GGA AAA GAC GGC TTC ATT TTA AAG AAC TAC ATA GAA ATG, which creates a new DraI site and mutates codon 49 from P to L. | Backbone Size:0; Vector Backbone:pSVE; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | P49L | 2026-09-01 09:51:33 | 1 |
|
pET28-MHL Resource Report Resource Website 10+ mentions |
RRID:Addgene_26096 | Kanamycin | The pET28-MHL vector (GenBank accession EF456735) was derived from expression plasmid pET28a-LIC (SGC). It is used for T7 promoter driven expression of recombinant proteins with the addition of an 18 amino acid N-terminal fusion tag containing 6X His followed by a TEV cleavage site. The GSS residues after the Met start site were removed to reduce N-terminal gluconoylation via preventing N-terminal Met excision. Two stop codons are included in the vector at the C-terminal cloning site. Insertion of DNA sequence into the cloning/expression region is performed using BD-Biosciences Infusion enzyme mediated directional recombination between complementary 15 nucleotide DNA sequences at the ends of the insert (PCR product) and BseRI linearized vector. Insertion of target sequence involves replacement of a SacB gene stuffer sequence, which provides for negative selection of the original plasmid on 5% sucrose. http://www.sgc.utoronto.ca/SGC-WebPages/toronto-vectors.php | Backbone Marker:Structural Genomics Consortium; Backbone Size:7325; Vector Backbone:pET28-MHL; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin | 2026-09-01 09:51:33 | 21 | ||||
|
pBS-elav-1 Resource Report Resource Website 1+ mentions |
RRID:Addgene_26130 | Smed-elav1 | Schmidtea mediterranea | Ampicillin | PMID:20844018 | Backbone Size:3000; Vector Backbone:pBluescript II SK(+); Vector Types:cloning; Bacterial Resistance:Ampicillin | 2026-09-01 09:51:34 | 1 | ||
|
pRK-ATF4 1-275 Resource Report Resource Website 1+ mentions |
RRID:Addgene_26118 | ATF4 | Homo sapiens | Ampicillin | PMID:19164757 | Backbone Marker:Dr. Hongbin Shu; Vector Backbone:pRK5-A20 (TNFAIP3); Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | aa's 276-351 have been deleted | 2026-09-01 09:51:34 | 1 | |
|
pRK-ATF4 Resource Report Resource Website 10+ mentions |
RRID:Addgene_26114 | ATF4 | Homo sapiens | Ampicillin | PMID:19164757 | Backbone Marker:Dr. Hongbin Shu; Vector Backbone:pRK5-A20 (TNFAIP3); Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-09-01 09:51:34 | 19 | ||
|
pNIC-CH Resource Report Resource Website 1+ mentions |
RRID:Addgene_26117 | Kanamycin | pET expression vector with C-terminal His6 tag. Includes sites for LIC cloning, and a “stuffer” fragment that includes the SacB gene, allowing negative selection on 5% sucrose. GenBank accession number: EF199843 Primers for LIC cloning: Add the following 5’ extensions to the PCR primers: Upstream: TTAAGAAGGAGATATACTATG (ATG-initiation codon) Downstream: AATGGTGGTGATGATGGTGCGC The purified PCR fragments are treated with T4 DNA polymerase and dGTP, then annealed to the treated vector. See supplemental document for more information. | Backbone Marker:SGC Oxford; Backbone Size:7218; Vector Backbone:pNIC-CH; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin | 2026-09-01 09:51:34 | 7 | ||||
|
pAAV-EF1a-FLEX-GT Resource Report Resource Website 10+ mentions |
RRID:Addgene_26198 | Enhanced green fluorescent protein, TVA | Mus musculus | Ampicillin | PMID:21115815 | Backbone Marker:Karl Deisseroth lab; Backbone Size:5300; Vector Backbone:pAAV-double floxed-EYFP-WPRE-pA; Vector Types:AAV, Cre/Lox; Bacterial Resistance:Ampicillin | TVA mammalian codon optimized | 2026-09-01 09:51:36 | 20 | |
|
PGL3-NOXA-N1 Resource Report Resource Website 1+ mentions |
RRID:Addgene_26112 | NOXA N1 | Homo sapiens | Ampicillin | PMID:19164757 | Backbone Size:5000; Vector Backbone:pGL3; Vector Types:Mammalian Expression, Luciferase; Bacterial Resistance:Ampicillin | 2026-09-01 09:51:34 | 3 | ||
|
pAAV-FLEX-hGTB Resource Report Resource Website 1+ mentions |
RRID:Addgene_26196 | Tet transactivator, enhanced green fluorescent protein, TVA, rabies B19 glycoprotein | Homo sapiens | Kanamycin | PMID:21115815 | Backbone Marker:Mr. Gene; Backbone Size:3300; Vector Backbone:pAAV; Vector Types:AAV, Cre/Lox, Adeno-associated virus; Bacterial Resistance:Kanamycin | F2A has 2A cleavage site deleted, producing htTA-eGFP fusion. tTA, TVA, and B19G are all mammalian codon optimized | 2026-09-01 09:51:36 | 3 | |
|
pTomo-Ras Resource Report Resource Website 1+ mentions |
RRID:Addgene_26292 | HRAS-V12 | Homo sapiens | Ampicillin | PMID:19122659 | From the paper: To construct pTomo H-RasV12, we amplified Flag-tagged H-RasV12 from pGEM H-RasV12 by PCR and inserted it into the BamHI site of the pTomo vector. | Backbone Marker:Verma lab; Backbone Size:8753; Vector Backbone:pTomo; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin | G12V | 2026-09-01 09:51:37 | 3 |
|
pSUPER IKKbeta Resource Report Resource Website 1+ mentions |
RRID:Addgene_26209 | pSUPER IKK beta | Homo sapiens | Ampicillin | PMID:12692549 | Backbone Size:3176; Vector Backbone:pSUPER; Vector Types:RNAi; Bacterial Resistance:Ampicillin | 2026-09-01 09:51:36 | 1 | ||
|
pJFRC-MUH Resource Report Resource Website 10+ mentions |
RRID:Addgene_26213 | Ampicillin | PMID:20697123 | Backbone Size:7831; Vector Backbone:pBDP; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin | 2026-09-01 09:51:36 | 27 | ||||
|
pSUPER TBK1 Resource Report Resource Website 1+ mentions |
RRID:Addgene_26210 | pSUPER TBK1 | Homo sapiens | Ampicillin | PMID:12692549 | Backbone Size:3176; Vector Backbone:pSUPER; Vector Types:RNAi; Bacterial Resistance:Ampicillin | 2026-09-01 09:51:36 | 3 | ||
|
pMOTag2H Resource Report Resource Website 1+ mentions |
RRID:Addgene_26296 | Ampicillin | Modifications giving different epitope tags and/or selectable markers made by members of the Cross lab to plasmids based on Oberholzer,M., Morand,S., Kunz,S., and Seebeck,T. A vector series for rapid PCR-mediated C-terminal in-situ tagging of T. brucei genes. Mol. Biochem. Parasitol. 145, 2005, 117-120. | Backbone Marker:Stratagene; Backbone Size:3952; Vector Backbone:pBluescript II KS+; Vector Types:Trypanosome in-situ tagging vector; Bacterial Resistance:Ampicillin | 2026-09-01 09:51:37 | 1 | ||||
|
pXN-FBLWLF-GAL4DBD Resource Report Resource Website 1+ mentions |
RRID:Addgene_26264 | ZIP- Gal4DBD | Saccharomyces cerevisiae | Ampicillin | PMID:21473015 | Luan et al. Neuron. 2006 Nov 9. 52(3):425-36. | Backbone Size:8757; Vector Backbone:pXN-FBLWLF; Vector Types:Bacterial Expression, Insect Expression, Drosophila transgenesis; Bacterial Resistance:Ampicillin | 2026-09-01 09:51:37 | 1 | |
|
pXN-FBLWLF-GAL4AD Resource Report Resource Website 1+ mentions |
RRID:Addgene_26263 | Gal4AD-Zip+ | Saccharomyces cerevisiae | Ampicillin | PMID:21473015 | Luan et al. Neuron. 2006 Nov 9. 52(3):425-36. | Backbone Size:8757; Vector Backbone:pXN-FBLWLF; Vector Types:Bacterial Expression, Insect Expression, Drosophila transgenesis; Bacterial Resistance:Ampicillin | 2026-09-01 09:51:37 | 1 | |
|
pGL2- Empty control -SV40-Luc Resource Report Resource Website 1+ mentions |
RRID:Addgene_26280 | pGL2-Control plasmid | Ampicillin | PMID:20442331 | Backbone kindly provided by Dr. Ron Mckay and Dr.Paul Tesar (Tesar et al. Nature 2007) | Backbone Size:6000; Vector Backbone:pGL2-SV40-Luc; Vector Types:Mammalian Expression, Luciferase; Bacterial Resistance:Ampicillin | 2026-09-01 09:51:37 | 6 |
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
