Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: trans-activator - KRAB
Genetic Insert: tTR-KRAB
Vector Backbone Description: Backbone Size:7569; Vector Backbone:pSin-EF2-Nanog; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22645348
Proper citation: RRID:Addgene_26122 Copy
Species: Rattus norvegicus
Genetic Insert: Synaptophysin GCaMP2
Vector Backbone Description: Backbone Size:3957; Vector Backbone:pEGFP-N1 (Clontech); Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:19898484
Comments: ORF frame 3 (624-2915): Rat SyGCaMP2.
Our sequence with CMV-F shows a mutation S199T in Synaptophysin ORF. This change does not have any effect in localizing the construct to the synaptic vesicle and may be a result of a SNP.
Proper citation: RRID:Addgene_26124 Copy
Species: Aquorea victoria
Genetic Insert: Precursor mT/mG
Vector Backbone Description: Backbone Size:5000; Vector Backbone:pCA-HZ2; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Proper citation: RRID:Addgene_26123 Copy
Species: Homo sapiens
Genetic Insert: Grb2 P49L
Vector Backbone Description: Backbone Size:0; Vector Backbone:pSVE; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:8479536
Comments: mutagenesis performed using oligo GGA AAA GAC GGC TTC ATT TTA AAG AAC TAC ATA GAA ATG, which creates a new DraI site and mutates codon 49 from P to L.
Proper citation: RRID:Addgene_26085 Copy
Vector Backbone Description: Backbone Marker:Structural Genomics Consortium; Backbone Size:7325; Vector Backbone:pET28-MHL; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Comments: The pET28-MHL vector (GenBank accession EF456735) was derived from expression plasmid pET28a-LIC (SGC). It is used for T7 promoter driven expression of recombinant proteins with the addition of an 18 amino acid N-terminal fusion tag containing 6X His followed by a TEV cleavage site. The GSS residues after the Met start site were removed to reduce N-terminal gluconoylation via preventing N-terminal Met excision. Two stop codons are included in the vector at the C-terminal cloning site.
Insertion of DNA sequence into the cloning/expression region is performed using BD-Biosciences Infusion enzyme mediated directional recombination between complementary 15 nucleotide DNA sequences at the ends of the insert (PCR product) and BseRI linearized vector. Insertion of target sequence involves replacement of a SacB gene stuffer sequence, which provides for negative selection of the original plasmid on 5% sucrose.
http://www.sgc.utoronto.ca/SGC-WebPages/toronto-vectors.php
Proper citation: RRID:Addgene_26096 Copy
Species: Schmidtea mediterranea
Genetic Insert: Smed-elav1
Vector Backbone Description: Backbone Size:3000; Vector Backbone:pBluescript II SK(+); Vector Types:cloning; Bacterial Resistance:Ampicillin
Defining Citation: PMID:20844018
Proper citation: RRID:Addgene_26130 Copy
Species: Homo sapiens
Genetic Insert: ATF4
Vector Backbone Description: Backbone Marker:Dr. Hongbin Shu; Vector Backbone:pRK5-A20 (TNFAIP3); Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19164757
Proper citation: RRID:Addgene_26118 Copy
Species: Homo sapiens
Genetic Insert: ATF4
Vector Backbone Description: Backbone Marker:Dr. Hongbin Shu; Vector Backbone:pRK5-A20 (TNFAIP3); Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19164757
Proper citation: RRID:Addgene_26114 Copy
Vector Backbone Description: Backbone Marker:SGC Oxford; Backbone Size:7218; Vector Backbone:pNIC-CH; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Comments: pET expression vector with C-terminal His6 tag. Includes sites for LIC cloning, and a “stuffer” fragment that includes the SacB gene, allowing negative selection on 5% sucrose. GenBank accession number: EF199843
Primers for LIC cloning:
Add the following 5’ extensions to the PCR primers:
Upstream: TTAAGAAGGAGATATACTATG (ATG-initiation codon)
Downstream: AATGGTGGTGATGATGGTGCGC
The purified PCR fragments are treated with T4 DNA polymerase and dGTP, then annealed to the treated vector. See supplemental document for more information.
Proper citation: RRID:Addgene_26117 Copy
Species: Mus musculus
Genetic Insert: Enhanced green fluorescent protein, TVA
Vector Backbone Description: Backbone Marker:Karl Deisseroth lab; Backbone Size:5300; Vector Backbone:pAAV-double floxed-EYFP-WPRE-pA; Vector Types:AAV, Cre/Lox; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21115815
Proper citation: RRID:Addgene_26198 Copy
Species: Homo sapiens
Genetic Insert: NOXA N1
Vector Backbone Description: Backbone Size:5000; Vector Backbone:pGL3; Vector Types:Mammalian Expression, Luciferase; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19164757
Proper citation: RRID:Addgene_26112 Copy
Species: Homo sapiens
Genetic Insert: Tet transactivator, enhanced green fluorescent protein, TVA, rabies B19 glycoprotein
Vector Backbone Description: Backbone Marker:Mr. Gene; Backbone Size:3300; Vector Backbone:pAAV; Vector Types:AAV, Cre/Lox, Adeno-associated virus; Bacterial Resistance:Kanamycin
Defining Citation: PMID:21115815
Proper citation: RRID:Addgene_26196 Copy
Species: Homo sapiens
Genetic Insert: HRAS-V12
Vector Backbone Description: Backbone Marker:Verma lab; Backbone Size:8753; Vector Backbone:pTomo; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19122659
Comments: From the paper: To construct pTomo H-RasV12, we amplified Flag-tagged H-RasV12 from pGEM H-RasV12 by PCR and inserted it into the BamHI site of the pTomo vector.
Proper citation: RRID:Addgene_26292 Copy
Species: Homo sapiens
Genetic Insert: pSUPER IKK beta
Vector Backbone Description: Backbone Size:3176; Vector Backbone:pSUPER; Vector Types:RNAi; Bacterial Resistance:Ampicillin
Defining Citation: PMID:12692549
Proper citation: RRID:Addgene_26209 Copy
Vector Backbone Description: Backbone Size:7831; Vector Backbone:pBDP; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:20697123
Proper citation: RRID:Addgene_26213 Copy
Species: Homo sapiens
Genetic Insert: pSUPER TBK1
Vector Backbone Description: Backbone Size:3176; Vector Backbone:pSUPER; Vector Types:RNAi; Bacterial Resistance:Ampicillin
Defining Citation: PMID:12692549
Proper citation: RRID:Addgene_26210 Copy
Vector Backbone Description: Backbone Marker:Stratagene; Backbone Size:3952; Vector Backbone:pBluescript II KS+; Vector Types:Trypanosome in-situ tagging vector; Bacterial Resistance:Ampicillin
Comments: Modifications giving different epitope tags and/or selectable markers made by members of the Cross lab to plasmids based on Oberholzer,M., Morand,S., Kunz,S., and Seebeck,T.
A vector series for rapid PCR-mediated C-terminal in-situ tagging of T. brucei genes. Mol. Biochem. Parasitol. 145, 2005, 117-120.
Proper citation: RRID:Addgene_26296 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: ZIP- Gal4DBD
Vector Backbone Description: Backbone Size:8757; Vector Backbone:pXN-FBLWLF; Vector Types:Bacterial Expression, Insect Expression, Drosophila transgenesis; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21473015
Comments: Luan et al. Neuron. 2006 Nov 9. 52(3):425-36.
Proper citation: RRID:Addgene_26264 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: Gal4AD-Zip+
Vector Backbone Description: Backbone Size:8757; Vector Backbone:pXN-FBLWLF; Vector Types:Bacterial Expression, Insect Expression, Drosophila transgenesis; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21473015
Comments: Luan et al. Neuron. 2006 Nov 9. 52(3):425-36.
Proper citation: RRID:Addgene_26263 Copy
Genetic Insert: pGL2-Control plasmid
Vector Backbone Description: Backbone Size:6000; Vector Backbone:pGL2-SV40-Luc; Vector Types:Mammalian Expression, Luciferase; Bacterial Resistance:Ampicillin
Defining Citation: PMID:20442331
Comments: Backbone kindly provided by Dr. Ron Mckay and Dr.Paul Tesar (Tesar et al. Nature 2007)
Proper citation: RRID:Addgene_26280 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within RRID that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
