Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
| Plasmid Name | Proper Citation | Insert Name | Organism | Bacterial Resistance | Defining Citation |
Comments |
||||
|---|---|---|---|---|---|---|---|---|---|---|
|
Kv1.2 K+ channel scFv [K14/16] Resource Report Resource Website |
RRID:Addgene_182064 | recombinant mouse scFv targeting Kv1.2 K+ channel (Homo sapiens) | Mus musculus | Ampicillin | PMID:37758930 | This is a recombinant scFv derived from RRID: AB_2895564. | Backbone Marker:Invitrogen; Backbone Size:5428; Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-09-01 09:31:16 | 0 | |
|
Kv2.1 K+ channel scFv [K89/34] Resource Report Resource Website |
RRID:Addgene_182069 | recombinant mouse scFv targeting Kv2.1 K+ channel (Rattus norvegicus) | Mus musculus | Ampicillin | PMID:37758930 | This is a recombinant scFv derived from RRID: AB_2895569. | Backbone Marker:Invitrogen; Backbone Size:5428; Vector Backbone:pcDNA3.4; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-09-01 09:31:16 | 0 | |
|
Bassoon scFv [L124/59] Resource Report Resource Website |
RRID:Addgene_182078 | recombinant mouse scFv targeting Bassoon (Rattus norvegicus) | Mus musculus | Ampicillin | PMID:37758930 | This is a recombinant scFv derived from RRID: AB_2895685. | Backbone Marker:Invitrogen; Backbone Size:5428; Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-09-01 09:31:16 | 0 | |
|
pCAG-FLAG-IRES-blasticidin-Sox2 T258A Resource Report Resource Website |
RRID:Addgene_182048 | Sox2 | Mus musculus | Ampicillin | PMID:34819616 | Vector Backbone:pCAG-FLAG-IRES-blasticidin; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | T258A | 2026-09-01 09:31:15 | 0 | |
|
pcDNA TfR1-miniE Resource Report Resource Website |
RRID:Addgene_181987 | TfR1-MiniE | Mus musculus | Ampicillin | PMID:32786411 | Backbone Marker:Invitrogen; Backbone Size:5428; Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-09-01 09:31:15 | 0 | ||
|
pMECP2-RFP Resource Report Resource Website |
RRID:Addgene_181905 | MECP2 | Mus musculus | Kanamycin | PMID:32101700 | Backbone Marker:Evrogen; Backbone Size:4700; Vector Backbone:pTagRFP-N; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin | 2026-09-01 09:31:13 | 0 | ||
|
Aldh1L1 scFv [N103/31] Resource Report Resource Website |
RRID:Addgene_182080 | recombinant mouse scFv targeting Aldh1L1 (Rattus norvegicus) | Mus musculus | Ampicillin | PMID:37758930 | This is a recombinant scFv derived from RRID: AB_2895575. | Backbone Marker:Invitrogen; Backbone Size:5428; Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-09-01 09:31:16 | 0 | |
|
TrpV1 scFv [N221/17] Resource Report Resource Website |
RRID:Addgene_182082 | recombinant mouse scFv targeting TrpV1 (Rattus norvegicus) | Mus musculus | Ampicillin | PMID:37758930 | This is a recombinant scFv derived from RRID: AB_2895577. GA code: 65E. | Backbone Marker:Invitrogen; Backbone Size:5428; Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-09-01 09:31:16 | 0 | |
|
Rufy3 scFv [N483/126] Resource Report Resource Website |
RRID:Addgene_182089 | recombinant mouse scFv targeting Rufy3 (Mus musculus) | Mus musculus | Ampicillin | PMID:37758930 | This is a recombinant scFv derived from RRID: AB_2895582. GA code: 19D, 19E. | Backbone Marker:Invitrogen; Backbone Size:5428; Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-09-01 09:31:17 | 0 | |
|
Cav1.2 Ca2+ channel scFv [N263/31] Resource Report Resource Website |
RRID:Addgene_182083 | recombinant mouse scFv targeting Cav1.2 Ca2+ channel (Rattus norvegicus) | Mus musculus | Ampicillin | PMID:37758930 | This is a recombinant scFv derived from RRID: AB_2895687. | Backbone Marker:Invitrogen; Backbone Size:5428; Vector Backbone:pcDNA3.4; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-09-01 09:31:16 | 0 | |
|
Arl13b scFv [N295B/66] Resource Report Resource Website |
RRID:Addgene_182086 | recombinant mouse scFv targeting Arl13b (Mus musculus) | Mus musculus | Ampicillin | PMID:37758930 | This is a recombinant scFv derived from RRID: AB_2895580. GA code: 70C. | Backbone Marker:Invitrogen; Backbone Size:5428; Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-09-01 09:31:16 | 0 | |
|
Mortalin/GRP75 scFv [N52A/42] Resource Report Resource Website |
RRID:Addgene_182091 | recombinant mouse scFv targeting Mortalin/GRP75 (Mus musculus) | Mus musculus | Ampicillin | PMID:37758930 | This is a recombinant scFv derived from RRID: AB_2895583. GA code: 80B. | Backbone Marker:Invitrogen; Backbone Size:5428; Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-09-01 09:31:17 | 0 | |
|
C-Fos scFv [N486/32] Resource Report Resource Website |
RRID:Addgene_182090 | recombinant mouse scFv targeting C-Fos (Homo sapiens) | Mus musculus | Ampicillin | PMID:37758930 | This is a recombinant scFv derived from RRID: AB_2895689. | Backbone Marker:Invitrogen; Backbone Size:5428; Vector Backbone:pcDNA3.4; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-09-01 09:31:17 | 0 | |
|
GluN2B/NR2B glutamate receptor scFv [N59/36] Resource Report Resource Website |
RRID:Addgene_182093 | recombinant mouse scFv targeting GluN2B/NR2B glutamate receptor (Rattus norvegicus) | Mus musculus | Ampicillin | PMID:37758930 | This is a recombinant scFv derived from RRID: AB_2895584. GA code: 59A. | Backbone Marker:Invitrogen; Backbone Size:5428; Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-09-01 09:31:17 | 0 | |
|
GFP scFv [N86/38] Resource Report Resource Website |
RRID:Addgene_182095 | recombinant mouse scFv targeting GFP | Mus musculus | Ampicillin | PMID:37758930 | This is a recombinant scFv derived from RRID: AB_2895586. | Backbone Marker:Invitrogen; Backbone Size:5428; Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-09-01 09:31:17 | 0 | |
|
PX552-mScn2a-3xV5-EF1-smFP-flag Resource Report Resource Website |
RRID:Addgene_182561 | mouse Scn2a gRNA and 3xV5 donor DNA | Mus musculus | Ampicillin | PMID:35672149 | Vector Backbone:PX552; Vector Types:AAV, CRISPR; Bacterial Resistance:Ampicillin | 2026-09-01 09:31:24 | 0 | ||
|
piggybac-Syn-mScn8a_ICL1-sfGFP-P2A-mCherry Resource Report Resource Website |
RRID:Addgene_182560 | mouse Scn8a ICL1 | Mus musculus | Ampicillin | PMID:35672149 | Vector Backbone:Piggybac; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-09-01 09:31:24 | 0 | ||
|
PX552-mScn8a-HaloTag-V5-EF1-sfGFP Resource Report Resource Website |
RRID:Addgene_182565 | mouse Scn8a gRNA and HaloTag-V5 donor DNA | Mus musculus | Ampicillin | PMID:35672149 | Vector Backbone:PX552; Vector Types:AAV, CRISPR; Bacterial Resistance:Ampicillin | 2026-09-01 09:31:24 | 0 | ||
|
PX552-mScn2a-HaloTag-V5-EF1-sfGFP Resource Report Resource Website |
RRID:Addgene_182564 | mouse Scn2a gRNA and HaloTag-V5 donor DNA | Mus musculus | Ampicillin | PMID:35672149 | Vector Backbone:PX552; Vector Types:AAV, CRISPR; Bacterial Resistance:Ampicillin | 2026-09-01 09:31:24 | 0 | ||
|
psiCheck2-SV40p-mtIF3(SR)-3xFLAG-HSVTKp-mCherry Resource Report Resource Website |
RRID:Addgene_182381 | mtIF3 | Mus musculus | Ampicillin | PMID:34996455 | Backbone Size:3639; Vector Backbone:psiCheck2; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | Changed CDS sequence from 'ccacgttcaagtcacgataaa' to 'tcatgtacaggtgaccattaa' (shRNA-resistant) | 2026-09-01 09:31:22 | 0 |
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
