Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Preparing word cloud

×

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search

Filter by records added date
See new records

Options


Current Facets and Filters

  • Organism:mus musculus (facet)


Recent searches

Snippet view Table view
Click the to add this resource to a Collection

12,978 Results - per page

Show More Columns | Download Top 1000 Results

Plasmid Name Proper Citation Insert Name Organism Bacterial Resistance Defining Citation Comments Vector Backbone Description Relevant Mutation Record Last Update Mentions Count
Kv1.2 K+ channel scFv [K14/16]
 
Resource Report
Resource Website
RRID:Addgene_182064 recombinant mouse scFv targeting Kv1.2 K+ channel (Homo sapiens) Mus musculus Ampicillin PMID:37758930 This is a recombinant scFv derived from RRID: AB_2895564. Backbone Marker:Invitrogen; Backbone Size:5428; Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-09-01 09:31:16 0
Kv2.1 K+ channel scFv [K89/34]
 
Resource Report
Resource Website
RRID:Addgene_182069 recombinant mouse scFv targeting Kv2.1 K+ channel (Rattus norvegicus) Mus musculus Ampicillin PMID:37758930 This is a recombinant scFv derived from RRID: AB_2895569. Backbone Marker:Invitrogen; Backbone Size:5428; Vector Backbone:pcDNA3.4; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-09-01 09:31:16 0
Bassoon scFv [L124/59]
 
Resource Report
Resource Website
RRID:Addgene_182078 recombinant mouse scFv targeting Bassoon (Rattus norvegicus) Mus musculus Ampicillin PMID:37758930 This is a recombinant scFv derived from RRID: AB_2895685. Backbone Marker:Invitrogen; Backbone Size:5428; Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-09-01 09:31:16 0
pCAG-FLAG-IRES-blasticidin-Sox2 T258A
 
Resource Report
Resource Website
RRID:Addgene_182048 Sox2 Mus musculus Ampicillin PMID:34819616 Vector Backbone:pCAG-FLAG-IRES-blasticidin; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin T258A 2026-09-01 09:31:15 0
pcDNA TfR1-miniE
 
Resource Report
Resource Website
RRID:Addgene_181987 TfR1-MiniE Mus musculus Ampicillin PMID:32786411 Backbone Marker:Invitrogen; Backbone Size:5428; Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-09-01 09:31:15 0
pMECP2-RFP
 
Resource Report
Resource Website
RRID:Addgene_181905 MECP2 Mus musculus Kanamycin PMID:32101700 Backbone Marker:Evrogen; Backbone Size:4700; Vector Backbone:pTagRFP-N; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin 2026-09-01 09:31:13 0
Aldh1L1 scFv [N103/31]
 
Resource Report
Resource Website
RRID:Addgene_182080 recombinant mouse scFv targeting Aldh1L1 (Rattus norvegicus) Mus musculus Ampicillin PMID:37758930 This is a recombinant scFv derived from RRID: AB_2895575. Backbone Marker:Invitrogen; Backbone Size:5428; Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-09-01 09:31:16 0
TrpV1 scFv [N221/17]
 
Resource Report
Resource Website
RRID:Addgene_182082 recombinant mouse scFv targeting TrpV1 (Rattus norvegicus) Mus musculus Ampicillin PMID:37758930 This is a recombinant scFv derived from RRID: AB_2895577. GA code: 65E. Backbone Marker:Invitrogen; Backbone Size:5428; Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-09-01 09:31:16 0
Rufy3 scFv [N483/126]
 
Resource Report
Resource Website
RRID:Addgene_182089 recombinant mouse scFv targeting Rufy3 (Mus musculus) Mus musculus Ampicillin PMID:37758930 This is a recombinant scFv derived from RRID: AB_2895582. GA code: 19D, 19E. Backbone Marker:Invitrogen; Backbone Size:5428; Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-09-01 09:31:17 0
Cav1.2 Ca2+ channel scFv [N263/31]
 
Resource Report
Resource Website
RRID:Addgene_182083 recombinant mouse scFv targeting Cav1.2 Ca2+ channel (Rattus norvegicus) Mus musculus Ampicillin PMID:37758930 This is a recombinant scFv derived from RRID: AB_2895687. Backbone Marker:Invitrogen; Backbone Size:5428; Vector Backbone:pcDNA3.4; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-09-01 09:31:16 0
Arl13b scFv [N295B/66]
 
Resource Report
Resource Website
RRID:Addgene_182086 recombinant mouse scFv targeting Arl13b (Mus musculus) Mus musculus Ampicillin PMID:37758930 This is a recombinant scFv derived from RRID: AB_2895580. GA code: 70C. Backbone Marker:Invitrogen; Backbone Size:5428; Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-09-01 09:31:16 0
Mortalin/GRP75 scFv [N52A/42]
 
Resource Report
Resource Website
RRID:Addgene_182091 recombinant mouse scFv targeting Mortalin/GRP75 (Mus musculus) Mus musculus Ampicillin PMID:37758930 This is a recombinant scFv derived from RRID: AB_2895583. GA code: 80B. Backbone Marker:Invitrogen; Backbone Size:5428; Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-09-01 09:31:17 0
C-Fos scFv [N486/32]
 
Resource Report
Resource Website
RRID:Addgene_182090 recombinant mouse scFv targeting C-Fos (Homo sapiens) Mus musculus Ampicillin PMID:37758930 This is a recombinant scFv derived from RRID: AB_2895689. Backbone Marker:Invitrogen; Backbone Size:5428; Vector Backbone:pcDNA3.4; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-09-01 09:31:17 0
GluN2B/NR2B glutamate receptor scFv [N59/36]
 
Resource Report
Resource Website
RRID:Addgene_182093 recombinant mouse scFv targeting GluN2B/NR2B glutamate receptor (Rattus norvegicus) Mus musculus Ampicillin PMID:37758930 This is a recombinant scFv derived from RRID: AB_2895584. GA code: 59A. Backbone Marker:Invitrogen; Backbone Size:5428; Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-09-01 09:31:17 0
GFP scFv [N86/38]
 
Resource Report
Resource Website
RRID:Addgene_182095 recombinant mouse scFv targeting GFP Mus musculus Ampicillin PMID:37758930 This is a recombinant scFv derived from RRID: AB_2895586. Backbone Marker:Invitrogen; Backbone Size:5428; Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-09-01 09:31:17 0
PX552-mScn2a-3xV5-EF1-smFP-flag
 
Resource Report
Resource Website
RRID:Addgene_182561 mouse Scn2a gRNA and 3xV5 donor DNA Mus musculus Ampicillin PMID:35672149 Vector Backbone:PX552; Vector Types:AAV, CRISPR; Bacterial Resistance:Ampicillin 2026-09-01 09:31:24 0
piggybac-Syn-mScn8a_ICL1-sfGFP-P2A-mCherry
 
Resource Report
Resource Website
RRID:Addgene_182560 mouse Scn8a ICL1 Mus musculus Ampicillin PMID:35672149 Vector Backbone:Piggybac; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-09-01 09:31:24 0
PX552-mScn8a-HaloTag-V5-EF1-sfGFP
 
Resource Report
Resource Website
RRID:Addgene_182565 mouse Scn8a gRNA and HaloTag-V5 donor DNA Mus musculus Ampicillin PMID:35672149 Vector Backbone:PX552; Vector Types:AAV, CRISPR; Bacterial Resistance:Ampicillin 2026-09-01 09:31:24 0
PX552-mScn2a-HaloTag-V5-EF1-sfGFP
 
Resource Report
Resource Website
RRID:Addgene_182564 mouse Scn2a gRNA and HaloTag-V5 donor DNA Mus musculus Ampicillin PMID:35672149 Vector Backbone:PX552; Vector Types:AAV, CRISPR; Bacterial Resistance:Ampicillin 2026-09-01 09:31:24 0
psiCheck2-SV40p-mtIF3(SR)-3xFLAG-HSVTKp-mCherry
 
Resource Report
Resource Website
RRID:Addgene_182381 mtIF3 Mus musculus Ampicillin PMID:34996455 Backbone Size:3639; Vector Backbone:psiCheck2; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin Changed CDS sequence from 'ccacgttcaagtcacgataaa' to 'tcatgtacaggtgaccattaa' (shRNA-resistant) 2026-09-01 09:31:22 0

Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
X
  1. RRID Portal Resources

    Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Collections

    If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  6. Facets

    Here are the facets that you can filter the data by.

  7. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.