Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
| Plasmid Name | Proper Citation | Insert Name | Organism | Bacterial Resistance | Defining Citation |
Comments |
||||
|---|---|---|---|---|---|---|---|---|---|---|
|
MSCVhyg-HA-FLAG_Ubc9_WT Resource Report Resource Website |
RRID:Addgene_164936 | human UBC9 | Homo sapiens | Ampicillin | PMID:25805818 | Backbone Size:6974; Vector Backbone:pMSCVhyg; Vector Types:Retroviral; Bacterial Resistance:Ampicillin | 2026-08-15 01:09:25 | 0 | ||
|
TC374 Resource Report Resource Website 1+ mentions |
RRID:Addgene_164886 | rpl28-rtTA(Q) | Caenorhabditis elegans | Ampicillin | PMID:30634168 | Vector Backbone:puc57; Vector Types:Worm Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:09:25 | 1 | ||
|
TC513 Resource Report Resource Website |
RRID:Addgene_164889 | rtetR-zip | Caenorhabditis elegans | Ampicillin | PMID:30634168 | Vector Backbone:puc57; Vector Types:Worm Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:09:25 | 0 | ||
|
MSCVpic2neo-EGFP-FF2 Resource Report Resource Website |
RRID:Addgene_164922 | Enhanced green fluorescent protein | Synthetic | Ampicillin | PMID:27891214 | Backbone Size:7140; Vector Backbone:MSCVpic2; Vector Types:Retroviral; Bacterial Resistance:Ampicillin | 2026-08-15 01:09:25 | 0 | ||
|
MSCVpic2blast-EGFP-FF2 Resource Report Resource Website |
RRID:Addgene_164923 | Enhanced green fluorescent protein | Synthetic | Ampicillin | PMID:27891214 | Backbone Size:6735; Vector Backbone:MSCVpic2; Vector Types:Retroviral; Bacterial Resistance:Ampicillin | 2026-08-15 01:09:25 | 0 | ||
|
TC562 Resource Report Resource Website |
RRID:Addgene_164887 | QFAD mutated | Caenorhabditis elegans | Ampicillin | PMID:30634168 | Vector Backbone:puc57; Vector Types:Worm Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:09:25 | 0 | ||
|
pInducer10b-HA-KRAS WT CO SR Resource Report Resource Website |
RRID:Addgene_164926 | KRAS proto-oncogene, GTPase (KRAS) | Homo sapiens | Ampicillin | PMID:25100204 | Backbone Size:12168; Vector Backbone:pInducer-10b; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin | 9 Valine codons are optimized and siRNA targeting sites are altered without effecting amino acid codons.. | 2026-08-15 01:09:25 | 0 | |
|
pInducer10b-EGFP-KRAS G12V Resource Report Resource Website 1+ mentions |
RRID:Addgene_164925 | Enhanced green fluorescent protein | Synthetic | Ampicillin | PMID:25093678 | Backbone Size:12176; Vector Backbone:pInducer-10b; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin | 2026-08-15 01:09:25 | 2 | ||
|
pDONR221-kcnma1a Resource Report Resource Website |
RRID:Addgene_164951 | kcnma1a | Danio rerio | Kanamycin | PMID:33728688 | The DNA sequence was amplified from pooled wild type TAB zebrafish embryos. There is a likely polymorphism, N416D, which is not listed in the current ENSEMBL database. This is possibly due to incomplete zebrafish genome annotation, GRCz11. But this will not impact the result of whole mount in situ hybridization | Backbone Marker:Invitrogen; Backbone Size:2550; Vector Backbone:pDONR221; Vector Types:PCR cloning vector; Bacterial Resistance:Kanamycin | 2026-08-15 01:09:25 | 0 | |
|
pDestTol2-pax3a-kcnj13-IRES-EGFP Resource Report Resource Website |
RRID:Addgene_164950 | kcnj13 | Danio rerio | Ampicillin | PMID:32546498 | Backbone Size:4179; Vector Backbone:pDestTol2pA2; Vector Types:Tol2 transposon destination vector; Bacterial Resistance:Ampicillin | 2026-08-15 01:09:25 | 0 | ||
|
pENTR-D-TOPO-kcnmb3 Resource Report Resource Website |
RRID:Addgene_164955 | kcnmb3 | Danio rerio | Kanamycin | PMID:33728688 | Backbone Marker:Invitrogen; Backbone Size:2580; Vector Backbone:pENTR-D-TOPO; Vector Types:PCR cloning vector; Bacterial Resistance:Kanamycin | 2026-08-15 01:09:25 | 0 | ||
|
pENTR-D-TOPO-kcnn1a Resource Report Resource Website |
RRID:Addgene_164956 | kcnn1a | Danio rerio | Kanamycin | PMID:33728688 | The DNA sequence was amplified from pooled wild-type TAB zebrafish embryos. According to the predicted sequence, XP_005171293.1, there are likely polymorphisms, K185E, H323Y, S599N, which are not listed in the current ENSEMBL database. This is possibly due to incomplete zebrafish genome annotation, GRCz11. In addition, at the 5’ end of the insert, there are 44bps extra forward primer dimer sequences (ATGCGGCATCGGCACGCGGGCCATGCGGCATCGGCACGCGGGCC) before the start codon. But this will not impact the result of the whole mount in situ hybridization. | Backbone Marker:Invitrogen; Backbone Size:2580; Vector Backbone:pENTR-D-TOPO; Vector Types:PCR cloning vector; Bacterial Resistance:Kanamycin | 2026-08-15 01:09:25 | 0 | |
|
pENTR-D-TOPO-kcnmb2a Resource Report Resource Website |
RRID:Addgene_164953 | kcnmb2a | Danio rerio | Kanamycin | PMID:33728688 | Backbone Marker:Invitrogen; Backbone Size:2580; Vector Backbone:pENTR-D-TOPO; Vector Types:PCR Cloning Vectror; Bacterial Resistance:Kanamycin | 2026-08-15 01:09:25 | 0 | ||
|
pENTR-D-TOPO-kcnn3 Resource Report Resource Website |
RRID:Addgene_164959 | kcnn3 | Danio rerio | Kanamycin | PMID:33728688 | Backbone Marker:Invitrogen; Backbone Size:2580; Vector Backbone:pENTR-D-TOPO; Vector Types:PCR cloning vector; Bacterial Resistance:Kanamycin | 2026-08-15 01:09:25 | 0 | ||
|
pENTR-D-TOPO-kcnn1b Resource Report Resource Website |
RRID:Addgene_164957 | kcnn1b | Danio rerio | Kanamycin | PMID:33728688 | Backbone Marker:Invitrogen; Backbone Size:2580; Vector Backbone:pENTR-D-TOPO; Vector Types:PCR cloning vector; Bacterial Resistance:Kanamycin | 2026-08-15 01:09:25 | 0 | ||
|
pENTR-D-TOPO-kcnn2 Resource Report Resource Website |
RRID:Addgene_164958 | kcnn2 | Danio rerio | Kanamycin | PMID:33728688 | Backbone Marker:Invitrogen; Backbone Size:2580; Vector Backbone:pENTR-D-TOPO; Vector Types:PCR cloning vector; Bacterial Resistance:Kanamycin | 2026-08-15 01:09:25 | 0 | ||
|
pDestTol2-actinb-kcnj13-IRES-EGFP Resource Report Resource Website |
RRID:Addgene_164941 | kcnj13 | Danio rerio | Ampicillin | PMID:32546498 | Backbone Size:4179; Vector Backbone:pDestTol2pA2; Vector Types:Tol2 transposon destination vector; Bacterial Resistance:Ampicillin | 2026-08-15 01:09:25 | 0 | ||
|
L4417 Resource Report Resource Website 1+ mentions |
RRID:Addgene_1649 | Ampicillin | See Fire Lab Vector Kit Documentation 1999. Fire Lab Miniprep Number pPD128.110, Ligation number L4417. | Backbone Size:3489; Vector Types:Worm Expression, RNAi; Bacterial Resistance:Ampicillin | 2026-08-15 01:09:25 | 6 | ||||
|
pDestTol2-actinb-kcnj13-M135R-EGFP Resource Report Resource Website |
RRID:Addgene_164944 | kcnj13 | Danio rerio | Ampicillin | PMID:32546498 | Backbone Size:4179; Vector Backbone:pDestTol2pA2; Vector Types:Tol2 transposon destination vector; Bacterial Resistance:Ampicillin | Stop codon deleted; M135R | 2026-08-15 01:09:25 | 0 | |
|
pDestTol2-actinb-kcnj13-Q153H-EGFP Resource Report Resource Website |
RRID:Addgene_164943 | kcnj13 | Danio rerio | Ampicillin | PMID:32546498 | Backbone Size:4179; Vector Backbone:pDestTol2pA2; Vector Types:Tol2 transposon destination vector; Bacterial Resistance:Ampicillin | Stop codon deleted; Q153H; M154I | 2026-08-15 01:09:25 | 0 |
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
