Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
| Plasmid Name | Proper Citation | Insert Name | Organism | Bacterial Resistance | Defining Citation |
Comments |
||||
|---|---|---|---|---|---|---|---|---|---|---|
|
psiCheck2-SV40p-mtIF3(SR)-3xFLAG-CMVp-mito-mTFP1 Resource Report Resource Website |
RRID:Addgene_182380 | mtIF3 | Mus musculus | Ampicillin | PMID:34996455 | Backbone Size:3386; Vector Backbone:psiCheck2; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | Changed CDS sequence from 'ccacgttcaagtcacgataaa' to 'tcatgtacaggtgaccattaa' (shRNA-resistant) | 2026-09-01 09:31:22 | 0 | |
|
PB-TO-ASCL1-DLX2 Resource Report Resource Website 1+ mentions |
RRID:Addgene_182307 | Ascl1 | Mus musculus | Ampicillin | PMID:40672309 | Backbone Size:12978; Vector Backbone:pUCM; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-09-01 09:31:20 | 2 | ||
|
pAAV2-mtIF3 shRNA_TagRFP657 Resource Report Resource Website |
RRID:Addgene_182367 | mtIF3 | Mus musculus | Ampicillin | PMID:34996455 | Backbone Size:5813; Vector Backbone:pAAV2; Vector Types:Mammalian Expression, AAV, RNAi; Bacterial Resistance:Ampicillin | 2026-09-01 09:31:21 | 0 | ||
|
pcDNA6-5'UTR(mtIF3)-Dendra2-3'UTR(mtIF3) Resource Report Resource Website |
RRID:Addgene_182369 | mtIF3 | Mus musculus | Ampicillin | PMID:34996455 | Backbone Size:4991; Vector Backbone:pcDNA6; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-09-01 09:31:22 | 0 | ||
|
pcDNA6-MRPS6-VN172 Resource Report Resource Website |
RRID:Addgene_182374 | Mrps6 | Mus musculus | Ampicillin | PMID:34996455 | Backbone Size:5060; Vector Backbone:pcDNA6; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-09-01 09:31:22 | 0 | ||
|
pcDNA6-MRPL50-VC155 Resource Report Resource Website |
RRID:Addgene_182373 | Mrpl50 | Mus musculus | Ampicillin | PMID:34996455 | Backbone Size:5060; Vector Backbone:pcDNA6; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-09-01 09:31:22 | 0 | ||
|
pcDNA6-5'UTR(mtIF3)-mtIF3-Dendra2-3'UTR(mtIF3) Resource Report Resource Website |
RRID:Addgene_182370 | mtIF3 | Mus musculus | Ampicillin | PMID:34996455 | Backbone Size:4991; Vector Backbone:pcDNA6; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-09-01 09:31:22 | 0 | ||
|
pcDNA6-mtIF3-Dendra2 Resource Report Resource Website |
RRID:Addgene_182371 | mtIF3 | Mus musculus | Ampicillin | PMID:34996455 | Backbone Size:5089; Vector Backbone:pcDNA6; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-09-01 09:31:22 | 0 | ||
|
pAAV-iCre-2A-venus Resource Report Resource Website |
RRID:Addgene_182499 | iCre-2A-Venus | Mus musculus | Ampicillin | PMID:35649726 | Please note there is a G6E in the insert. Depositor confirms this mutation does not affect plasmid function. | Backbone Size:310; Vector Backbone:pUC; Vector Types:Mammalian Expression, AAV, Cre/Lox; Bacterial Resistance:Ampicillin | 2026-09-01 09:31:23 | 0 | |
|
psiCheck2-SV40p-5'UTR-mtIF3(SR)-3xFLAG-3'UTR-HSVTKp-mCherry Resource Report Resource Website |
RRID:Addgene_182379 | mtIF3 | Mus musculus | Ampicillin | PMID:34996455 | Backbone Size:3679; Vector Backbone:psiCheck2; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | Changed CDS sequence from 'ccacgttcaagtcacgataaa' to 'tcatgtacaggtgaccattaa' (shRNA-resistant) | 2026-09-01 09:31:22 | 0 | |
|
FRAP Resource Report Resource Website |
RRID:Addgene_1827 | FR1 AP | Mus musculus | Ampicillin | PMID:1309590 | See scanned map. (Leder #C-281) | Backbone Size:0; Vector Backbone:APtag-1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-09-01 09:31:27 | 0 | |
|
pSK-c-mpl Resource Report Resource Website |
RRID:Addgene_1828 | c-mpl | Mus musculus | Ampicillin | PMID:8334987 | See scanned map. (Leder #C-320) | Backbone Marker:Stratagene; Backbone Size:3000; Vector Backbone:pBluescript II SK; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | 2026-09-01 09:31:28 | 0 | |
|
pBluescript SK +/- mTRF1 Resource Report Resource Website 1+ mentions |
RRID:Addgene_12303 | mTRF1 | Mus musculus | Ampicillin | PMID:9002672 | Backbone Marker:Stratagene; Backbone Size:2900; Vector Backbone:pBluescript SK +/-; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | 2026-09-01 09:15:26 | 1 | ||
|
Flag-mFoxJ1 Resource Report Resource Website |
RRID:Addgene_122965 | mouse FoxJ1 | Mus musculus | Ampicillin | The mouse FoxJ1 cDNA was kindly provided by Dr. Steven Brody at Washington University. | Vector Backbone:pCD-betaG-FLAG; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-09-01 09:15:25 | 0 | ||
|
mIL12-N1 Resource Report Resource Website |
RRID:Addgene_123139 | Murine IL12 tandem p40 p35 | Mus musculus | Kanamycin | PMID:32034097 | Backbone Marker:clonTech; Backbone Size:4000; Vector Backbone:N1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin | 2026-09-01 09:15:28 | 0 | ||
|
pBabe puro IkB alpha M Resource Report Resource Website 1+ mentions |
RRID:Addgene_12332 | IkB alpha M | Mus musculus | Ampicillin | Backbone Marker:Available at Addgene (plasmid #1764); Backbone Size:5169; Vector Backbone:pBABE puro; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin | Dominant-negative mutant. Many signal transduction pathways resulting in NF-B activation culminate in a serine phosphorylation of IkB on residues 32 and 36. Phosphorylation of the COOH-terminal PEST sequence has been implicated in constitutive turnover of IkB. We combined the NH2- and COOH-terminal phosphorylation mutants into a single cDNA for this plasmid. | 2026-09-01 09:15:32 | 3 | ||
|
CMV IkB alpha Resource Report Resource Website 1+ mentions |
RRID:Addgene_12333 | IkB alpha | Mus musculus | Ampicillin | Backbone Size:0; Vector Backbone:n/a (CMV promoter); Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-09-01 09:15:32 | 1 | |||
|
pLXSN IkB alpha M Resource Report Resource Website 1+ mentions |
RRID:Addgene_12330 | IkB alpha M | Mus musculus | Ampicillin | PMID:8864120 | pCMX-IkB alpha M was generated by digestion of plasmids pCMX-IkBS32/36A and pCMX-IkBMutF with Eco NI and Bst EII and ligation of the small S32/36A fragment to the large vector/IkBMutF fragment. pLXSN-IkB alpha M was constructed by blunt insertion of the Eco RV fragment from pCMX-IkBM into the Hpa I site of pLXSN. | Backbone Marker:Clontech; Backbone Size:5900; Vector Backbone:pLXSN; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin | Dominant-negative mutant. Many signal transduction pathways resulting in NF-B activation culminate in a serine phosphorylation of IkB on residues 32 and 36. Phosphorylation of the COOH-terminal PEST sequence has been implicated in constitutive turnover of IkB. We combined the NH2- and COOH-terminal phosphorylation mutants into a single cDNA for this plasmid. | 2026-09-01 09:15:31 | 4 |
|
pBD-0071 Resource Report Resource Website |
RRID:Addgene_12339 | VCP K251A | Mus musculus | Kanamycin | PMID:16713576 | Backbone Size:5400; Vector Backbone:pET-28a; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin | K251A | 2026-09-01 09:15:33 | 0 | |
|
pcDNA6-N-3XFLAG-Axin1 Resource Report Resource Website |
RRID:Addgene_123463 | Axin 1 | Mus musculus | Ampicillin | PMID:31073040 | Backbone Size:5079; Vector Backbone:pcDNA6; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-09-01 09:15:34 | 0 |
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
