Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Mus musculus
Genetic Insert: Klf5
Vector Backbone Description: Backbone Marker:Oligoengine; Vector Backbone:pSuper-Retro; Vector Types:RNAi; Bacterial Resistance:Ampicillin
Defining Citation: PMID:17158781
Proper citation: RRID:Addgene_41740 Copy
Species: Mus musculus
Genetic Insert: Notch-1 Lin-Notch-glp (LNG) repeat-containing construct, CC->SS
Vector Backbone Description: Backbone Size:4352; Vector Backbone:pCS2+MT; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:10882062
Comments: Alternate plasmid name: pCS2 NLNR CC>SS-6MT
All Notch1 constructs deposited here were cloned into the pCS2+MT vector (Rupp et al., 1994; Turner and Weintraub, 1994) and have the C-terminal 348 residues (aa 2185 to C terminus) of Notch replaced with a hexameric myc tag to facilitate biochemical analysis. PCR mutagenesis was used to create the C1675S and C1682S mutations in LNR (Addgene plasmid #41738).
Proper citation: RRID:Addgene_41739 Copy
Species: Mus musculus
Genetic Insert: Notch-1 Intracellular Domain
Vector Backbone Description: Backbone Size:4352; Vector Backbone:pCS2+MT; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:9620803
Comments: Alternate plasmid name: pCS2 NICv1744-6MT
To create pCS2+ NICV1744, the primer CCAGGATCCACCATGGTGCTGCTGTCCCGCAAGC was used with primer M95 (5'-TCGAACATTGACATCCATGCA-3') to generate a product that was digested with Bam HI and Bcl I, and ligated into the same sites in NΔE (Addgene plasmid #41737).
Proper citation: RRID:Addgene_41730 Copy
Species: Mus musculus
Genetic Insert: Trp53
Vector Backbone Description: Backbone Size:9364; Vector Backbone:pCE; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23193063
Proper citation: RRID:Addgene_41856 Copy
Species: Mus musculus
Genetic Insert: Frizzled 7
Vector Backbone Description: Vector Backbone:pRK5; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23095888
Proper citation: RRID:Addgene_42259 Copy
Species: Mus musculus
Genetic Insert: Frizzled 2
Vector Backbone Description: Vector Backbone:pRK5; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23095888
Comments: Fzd2 insert contains S193A compared with NM_020510.2. Mutation has no effect on plasmid function
Proper citation: RRID:Addgene_42254 Copy
Species: Mus musculus
Genetic Insert: Frizzled 4
Vector Backbone Description: Vector Backbone:pRK5; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23095888
Proper citation: RRID:Addgene_42256 Copy
Species: Mus musculus
Genetic Insert: Frizzled 6
Vector Backbone Description: Vector Backbone:pRK5; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23095888
Proper citation: RRID:Addgene_42258 Copy
Species: Mus musculus
Genetic Insert: Frizzled 4
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:4700; Vector Backbone:pEGFP-N2; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:12958364
Comments: Fz4-GFP was generated by fusing EGFP (Clontech) at its C-terminus.
Alternate plasmid names: pEGFPN2 mFz4; pEGFP-N2-Frizzled4
Proper citation: RRID:Addgene_42197 Copy
Species: Mus musculus
Genetic Insert: G protein Gamma 3(F70A, F71A)
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5428; Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23213235
Comments: Mutations created by using the Quik Change Mutagenesis kit.
Proper citation: RRID:Addgene_42185 Copy
Species: Mus musculus
Genetic Insert: Gamma 3(K68A,K69A,F70A,F71A)
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5428; Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23213235
Comments: Mutations created by using the Quik Change mutagenesis kit
Proper citation: RRID:Addgene_42189 Copy
Species: Mus musculus
Genetic Insert: Wnt16
Vector Backbone Description: Vector Backbone:pRK5; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23095888
Proper citation: RRID:Addgene_42291 Copy
Species: Mus musculus
Genetic Insert: Wnt8a
Vector Backbone Description: Vector Backbone:pRK5; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23095888
Proper citation: RRID:Addgene_42284 Copy
Species: Mus musculus
Genetic Insert: Wnt8b
Vector Backbone Description: Vector Backbone:pRK5; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23095888
Proper citation: RRID:Addgene_42285 Copy
Species: Mus musculus
Genetic Insert: Wnt9b
Vector Backbone Description: Vector Backbone:pRK5; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23095888
Proper citation: RRID:Addgene_42287 Copy
Species: Mus musculus
Genetic Insert: Wnt10b
Vector Backbone Description: Vector Backbone:pRK5; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23095888
Proper citation: RRID:Addgene_42289 Copy
Species: Mus musculus
Genetic Insert: Wnt5b
Vector Backbone Description: Vector Backbone:pRK5; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23095888
Proper citation: RRID:Addgene_42280 Copy
Species: Mus musculus
Genetic Insert: Wnt7b
Vector Backbone Description: Vector Backbone:pRK5; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23095888
Proper citation: RRID:Addgene_42283 Copy
Species: Mus musculus
Genetic Insert: Wnt2
Vector Backbone Description: Vector Backbone:pRK5; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23095888
Proper citation: RRID:Addgene_42274 Copy
Species: Mus musculus
Genetic Insert: Wnt3
Vector Backbone Description: Vector Backbone:pRK5; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23095888
Proper citation: RRID:Addgene_42276 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within RRID that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
