Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Preparing word cloud

×

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search

Filter by records added date
See new records

Options


Current Facets and Filters

  • Organism:mus musculus (facet)


Recent searches

Snippet view Table view
Click the to add this resource to a Collection

12,959 Results - per page

Show More Columns | Download Top 1000 Results

Plasmid Name Proper Citation Insert Name Organism Bacterial Resistance Defining Citation Comments Vector Backbone Description Relevant Mutation Record Last Update Mentions Count
pSR-siKlf5
 
Resource Report
Resource Website
RRID:Addgene_41740 Klf5 Mus musculus Ampicillin PMID:17158781 Backbone Marker:Oligoengine; Vector Backbone:pSuper-Retro; Vector Types:RNAi; Bacterial Resistance:Ampicillin 2026-08-15 01:14:48 0
pCS2 Notch1 LNG (CC→SS)-6MT
 
Resource Report
Resource Website
RRID:Addgene_41739 Notch-1 Lin-Notch-glp (LNG) repeat-containing construct, CC->SS Mus musculus Ampicillin PMID:10882062 Alternate plasmid name: pCS2 NLNR CC>SS-6MT All Notch1 constructs deposited here were cloned into the pCS2+MT vector (Rupp et al., 1994; Turner and Weintraub, 1994) and have the C-terminal 348 residues (aa 2185 to C terminus) of Notch replaced with a hexameric myc tag to facilitate biochemical analysis. PCR mutagenesis was used to create the C1675S and C1682S mutations in LNR (Addgene plasmid #41738). Backbone Size:4352; Vector Backbone:pCS2+MT; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin Contains murine Notch-1 leader peptide (aa 1-23) and then protein from the extracellular lin-Notch-glp (LNG) repeats to residue 2184 (aa 1448-2184); C1675S, C1682S 2026-08-15 01:14:48 0
pCS2 Notch1 ICv-6MT
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_41730 Notch-1 Intracellular Domain Mus musculus Ampicillin PMID:9620803 Alternate plasmid name: pCS2 NICv1744-6MT To create pCS2+ NICV1744, the primer CCAGGATCCACCATGGTGCTGCTGTCCCGCAAGC was used with primer M95 (5'-TCGAACATTGACATCCATGCA-3') to generate a product that was digested with Bam HI and Bcl I, and ligated into the same sites in NΔE (Addgene plasmid #41737). Backbone Size:4352; Vector Backbone:pCS2+MT; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin Contains murine Notch-1 protein beginning at Valine 1744 (aa 1744-2184) 2026-08-15 01:14:47 3
pCE-mp53DD
 
Resource Report
Resource Website
50+ mentions
RRID:Addgene_41856 Trp53 Mus musculus Ampicillin PMID:23193063 Backbone Size:9364; Vector Backbone:pCE; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin Δ40-903 2026-08-15 01:14:48 69
pRK5-mFzd7
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_42259 Frizzled 7 Mus musculus Ampicillin PMID:23095888 Vector Backbone:pRK5; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:14:52 4
pRK5-mFzd2
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_42254 Frizzled 2 Mus musculus Ampicillin PMID:23095888 Fzd2 insert contains S193A compared with NM_020510.2. Mutation has no effect on plasmid function Vector Backbone:pRK5; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:14:52 2
pRK5-mFzd4
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_42256 Frizzled 4 Mus musculus Ampicillin PMID:23095888 Vector Backbone:pRK5; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:14:52 3
pRK5-mFzd6
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_42258 Frizzled 6 Mus musculus Ampicillin PMID:23095888 Vector Backbone:pRK5; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:14:52 3
Fz4-GFP
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_42197 Frizzled 4 Mus musculus Kanamycin PMID:12958364 Fz4-GFP was generated by fusing EGFP (Clontech) at its C-terminus. Alternate plasmid names: pEGFPN2 mFz4; pEGFP-N2-Frizzled4 Backbone Marker:Clontech; Backbone Size:4700; Vector Backbone:pEGFP-N2; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin 2026-08-15 01:14:51 3
EGFP G protein Gamma 3(F70A,F71A) in pcDNA3.1
 
Resource Report
Resource Website
RRID:Addgene_42185 G protein Gamma 3(F70A, F71A) Mus musculus Ampicillin PMID:23213235 Mutations created by using the Quik Change Mutagenesis kit. Backbone Marker:Invitrogen; Backbone Size:5428; Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin F70A, F71A 2026-08-15 01:14:51 0
EGFP G protein Gamma 3(K68A,K69A,F70A,F71A) in pcDNA3.1
 
Resource Report
Resource Website
RRID:Addgene_42189 Gamma 3(K68A,K69A,F70A,F71A) Mus musculus Ampicillin PMID:23213235 Mutations created by using the Quik Change mutagenesis kit Backbone Marker:Invitrogen; Backbone Size:5428; Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin K68A,K69A,F70A,F71A 2026-08-15 01:14:51 0
pRK5-mWnt16
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_42291 Wnt16 Mus musculus Ampicillin PMID:23095888 Vector Backbone:pRK5; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:14:52 1
pRK5-mWnt8a
 
Resource Report
Resource Website
RRID:Addgene_42284 Wnt8a Mus musculus Ampicillin PMID:23095888 Vector Backbone:pRK5; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:14:52 0
pRK5-mWnt8b
 
Resource Report
Resource Website
RRID:Addgene_42285 Wnt8b Mus musculus Ampicillin PMID:23095888 Vector Backbone:pRK5; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:14:52 0
pRK5-mWnt9b
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_42287 Wnt9b Mus musculus Ampicillin PMID:23095888 Vector Backbone:pRK5; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:14:52 1
pRK5-mWnt10b
 
Resource Report
Resource Website
RRID:Addgene_42289 Wnt10b Mus musculus Ampicillin PMID:23095888 Vector Backbone:pRK5; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:14:52 0
pRK5-mWnt5b
 
Resource Report
Resource Website
RRID:Addgene_42280 Wnt5b Mus musculus Ampicillin PMID:23095888 Vector Backbone:pRK5; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:14:52 0
pRK5-mWnt7b
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_42283 Wnt7b Mus musculus Ampicillin PMID:23095888 Vector Backbone:pRK5; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:14:52 1
pRK5-mWnt2
 
Resource Report
Resource Website
RRID:Addgene_42274 Wnt2 Mus musculus Ampicillin PMID:23095888 Vector Backbone:pRK5; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:14:52 0
pRK5-mWnt3
 
Resource Report
Resource Website
RRID:Addgene_42276 Wnt3 Mus musculus Ampicillin PMID:23095888 Vector Backbone:pRK5; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:14:52 0

Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
X
  1. RRID Portal Resources

    Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Collections

    If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  6. Facets

    Here are the facets that you can filter the data by.

  7. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.