Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search

On page 490 showing 9781 ~ 9800 out of 178,636 results
Snippet view Table view Download Top 1000 Results
Click the to add this resource to a Collection
  • RRID:Addgene_137101

    This resource has 1+ mentions.

http://www.addgene.org/137101

Species: Synthetic
Genetic Insert: G(TP)4TG
Vector Backbone Description: Vector Backbone:pL2; Vector Types:Synthetic Biology; Bacterial Resistance:Kanamycin
Defining Citation: PMID:31925441

Proper citation: RRID:Addgene_137101 Copy   


  • RRID:Addgene_137067

http://www.addgene.org/137067

Species: Borrelia burgdorferi B31
Genetic Insert: AAC66700.1
Vector Backbone Description: Vector Backbone:pelB-MBP (DNASU access no. EvNO00813783); Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:31772280
Comments: This plasmid uses the T7lac promoter to express in E. coli the mature (lacking the signal peptide), wild-type protein containing an N-terminal PelB signal peptide + His10 + mature maltose binding protein + TEV protease cleavage site. The gene encoding the protein does not have the same DNA sequence as B. burgdorferi because the gene has been optimized for expression in E. coli. BB0323 is a lipoprotein. BB0323 is not expected to be lipidated in this construct. After TEV cleavage, the target protein has an added A residue at the N-terminus of the mature protein.

Proper citation: RRID:Addgene_137067 Copy   


  • RRID:Addgene_137102

    This resource has 1+ mentions.

http://www.addgene.org/137102

Species: Synthetic
Genetic Insert: GGASPAGG
Vector Backbone Description: Vector Backbone:pL2; Vector Types:Synthetic Biology; Bacterial Resistance:Kanamycin
Defining Citation: PMID:31925441

Proper citation: RRID:Addgene_137102 Copy   


  • RRID:Addgene_137104

    This resource has 1+ mentions.

http://www.addgene.org/137104

Species: Synthetic
Genetic Insert: GGA(EAAAK)2AGG
Vector Backbone Description: Vector Backbone:pL2; Vector Types:Synthetic Biology; Bacterial Resistance:Kanamycin
Defining Citation: PMID:31925441

Proper citation: RRID:Addgene_137104 Copy   


  • RRID:Addgene_137108

    This resource has 1+ mentions.

http://www.addgene.org/137108

Species: Synthetic
Genetic Insert: FKBP12
Vector Backbone Description: Vector Backbone:pFD; Vector Types:Synthetic Biology; Bacterial Resistance:Kanamycin
Defining Citation: PMID:31925441

Proper citation: RRID:Addgene_137108 Copy   


  • RRID:Addgene_137070

http://www.addgene.org/137070

Species: Borrelia burgdorferi B31
Genetic Insert: BB0323
Vector Backbone Description: Vector Backbone:pCC1-4k; Vector Types:Bacterial Expression; Bacterial Resistance:Chloramphenicol
Defining Citation: PMID:31772280
Comments: For use as a PCR template for the expression optimized genes encoding BB0323, P13, DipA, Lmp1. RK2 origin of replication.

Proper citation: RRID:Addgene_137070 Copy   


  • RRID:Addgene_137075

    This resource has 1+ mentions.

http://www.addgene.org/137075

Genetic Insert: mNeonGreen DNA synthesis product with 5' and 3' extensions for Golden Gate cloning
Vector Backbone Description: Backbone Marker:Thermo Fisher Scientific; Vector Backbone:pMS-T GeneArt® cloning vector; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Spectinomycin
Defining Citation: PMID:32072132
Comments: If you have any queries or discover any errors, please contact Sherif El-Sharnouby at [email protected] or [email protected]. Please visit https://www.biorxiv.org/content/10.1101/649160v1.full for bioRxiv preprint.

Proper citation: RRID:Addgene_137075 Copy   


http://www.addgene.org/137074

Genetic Insert: mTurquoise2 DNA synthesis product with 5' and 3' extensions for Golden Gate cloning
Vector Backbone Description: Backbone Marker:Thermo Fisher Scientific; Vector Backbone:pMS GeneArt® cloning vector; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Spectinomycin
Defining Citation: PMID:32072132
Comments: If you have any queries or discover any errors, please contact Sherif El-Sharnouby at [email protected] or [email protected]. Please visit https://www.biorxiv.org/content/10.1101/649160v1.full for bioRxiv preprint.

Proper citation: RRID:Addgene_137074 Copy   


  • RRID:Addgene_137077

http://www.addgene.org/137077

Genetic Insert: mKOκ DNA synthesis product with 5' and 3' extensions for Golden Gate cloning
Vector Backbone Description: Backbone Marker:Thermo Fisher Scientific; Vector Backbone:pMS-T GeneArt® cloning vector; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Spectinomycin
Defining Citation: PMID:32072132
Comments: If you have any queries or discover any errors, please contact Sherif El-Sharnouby at [email protected] or [email protected]. Please visit https://www.biorxiv.org/content/10.1101/649160v1.full for bioRxiv preprint.

Proper citation: RRID:Addgene_137077 Copy   


http://www.addgene.org/137076

Genetic Insert: mClover3 DNA synthesis product with 5' and 3' extensions for Golden Gate cloning
Vector Backbone Description: Backbone Marker:Thermo Fisher Scientific; Vector Backbone:pMS-T GeneArt® cloning vector; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Spectinomycin
Defining Citation: PMID:32072132
Comments: If you have any queries or discover any errors, please contact Sherif El-Sharnouby at [email protected] or [email protected]. Please visit https://www.biorxiv.org/content/10.1101/649160v1.full for bioRxiv preprint.

Proper citation: RRID:Addgene_137076 Copy   


  • RRID:Addgene_13711

    This resource has 1+ mentions.

http://www.addgene.org/13711

Species: Homo sapiens
Genetic Insert: HPV 16 early region
Vector Backbone Description: Backbone Size:7500; Vector Backbone:pB-actin; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:2476573

Proper citation: RRID:Addgene_13711 Copy   


  • RRID:Addgene_137111

    This resource has 1+ mentions.

http://www.addgene.org/137111

Species: Synthetic
Genetic Insert: AI(TVMV)
Vector Backbone Description: Vector Backbone:pFD; Vector Types:Synthetic Biology; Bacterial Resistance:Kanamycin
Defining Citation: PMID:31925441

Proper citation: RRID:Addgene_137111 Copy   


  • RRID:Addgene_137114

http://www.addgene.org/137114

Species: Synthetic
Genetic Insert: mNeongreen-(GGS)2-Cfa(N)
Vector Backbone Description: Vector Backbone:pFLinkC-XE; Vector Types:Synthetic Biology; Bacterial Resistance:Ampicillin
Defining Citation: PMID:31925441
Comments: mNeongreen as negative selection marker

Proper citation: RRID:Addgene_137114 Copy   


http://www.addgene.org/137117

Species: Synthetic
Genetic Insert: AI(G3)-PDZ(GPG-G)FN3(GGS4)-TVMV
Vector Backbone Description: Vector Backbone:pFLinkC-XE; Vector Types:Synthetic Biology; Bacterial Resistance:Ampicillin
Defining Citation: PMID:31925441

Proper citation: RRID:Addgene_137117 Copy   


  • RRID:Addgene_137086

http://www.addgene.org/137086

Species: Homo sapiens
Genetic Insert: mCherry
Vector Backbone Description: Backbone Size:3168; Vector Backbone:pUC19; Vector Types:Bacterial Expression, PCR template for donor DNA; Bacterial Resistance:Ampicillin
Defining Citation: PMID:31710422

Proper citation: RRID:Addgene_137086 Copy   


  • RRID:Addgene_137088

http://www.addgene.org/137088

Species: Homo sapiens
Genetic Insert: tagRFP
Vector Backbone Description: Backbone Size:3168; Vector Backbone:pUC19; Vector Types:Bacterial Expression, PCR template for donor DNA; Bacterial Resistance:Ampicillin
Defining Citation: PMID:31710422

Proper citation: RRID:Addgene_137088 Copy   


http://www.addgene.org/137123

Species: Synthetic
Genetic Insert: Con/Foff 2.0-GCaMP6F
Vector Backbone Description: Backbone Size:5300; Vector Backbone:AAV2-EF1a-WPRE; Vector Types:AAV, Cre/Lox, Synthetic Biology, Flp/FRT; Bacterial Resistance:Ampicillin
Defining Citation: PMID:32574559
Comments: Additional sequencing primers: Intron 1F GGGACGACATGACTTAACCAG; Intron 1R CCAGCCCTTCTCATGTTCAG

Proper citation: RRID:Addgene_137123 Copy   


  • RRID:Addgene_137122

    This resource has 1+ mentions.

http://www.addgene.org/137122

Species: Synthetic
Genetic Insert: Con/Fon-GCaMP6F
Vector Backbone Description: Backbone Size:5300; Vector Backbone:AAV2-EF1a-WPRE; Vector Types:AAV, Cre/Lox, Synthetic Biology, Flp/FRT; Bacterial Resistance:Ampicillin
Defining Citation: PMID:32574559
Comments: Additional sequencing primers: Intron 1F GGGACGACATGACTTAACCAG; Intron 1R CCAGCCCTTCTCATGTTCAG

Proper citation: RRID:Addgene_137122 Copy   


  • RRID:Addgene_137125

    This resource has 1+ mentions.

http://www.addgene.org/137125

Species: Synthetic
Genetic Insert: sRGECO
Vector Backbone Description: Backbone Size:5300; Vector Backbone:AAV2-EF1a-WPRE; Vector Types:AAV; Bacterial Resistance:Ampicillin
Defining Citation: PMID:32574559

Proper citation: RRID:Addgene_137125 Copy   


  • RRID:Addgene_137124

    This resource has 1+ mentions.

http://www.addgene.org/137124

Species: Synthetic
Genetic Insert: Coff/Fon-GCaMP6F
Vector Backbone Description: Backbone Size:5300; Vector Backbone:AAV2-EF1a-WPRE; Vector Types:AAV, Cre/Lox, Synthetic Biology, Flp/FRT; Bacterial Resistance:Ampicillin
Defining Citation: PMID:32574559
Comments: Additional sequencing primers: Intron 1F GGGACGACATGACTTAACCAG; Intron 1R CCAGCCCTTCTCATGTTCAG

Proper citation: RRID:Addgene_137124 Copy   



Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
  1. RRID Portal Resources

    Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Save Your Search

    You can save any searches you perform for quick access to later from here.

  6. Query Expansion

    We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.

  7. Collections

    If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  8. Sources

    Here are the sources that were queried against in your search that you can investigate further.

  9. Categories

    Here are the categories present within RRID that you can filter your data on

  10. Subcategories

    Here are the subcategories present within this category that you can filter your data on

  11. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

X