Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Homo sapiens
Genetic Insert: Karyopherin Alpha 1
Vector Backbone Description: Backbone Marker:Promega; Backbone Size:4050; Vector Backbone:pCMVTNT; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:20701745
Comments: S73N is a reported SNP in the KPNA1 sequence. For more information, please see: https://www.ncbi.nlm.nih.gov/projects/SNP/snp_ref.cgi?type=rs&rs=4678193
Proper citation: RRID:Addgene_26677 Copy
Species: Homo sapiens
Genetic Insert: UBF1
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:4700; Vector Backbone:pEGFP-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:11285283
Proper citation: RRID:Addgene_26672 Copy
Species: Homo sapiens
Genetic Insert: Fibrillarin
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:4700; Vector Backbone:pEGFP-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:11285283
Proper citation: RRID:Addgene_26673 Copy
Species: Bacteriophage P1
Genetic Insert: Cre
Vector Backbone Description: Backbone Size:6000; Vector Backbone:pCAG-IRES2-GFP; Vector Types:Mammalian Expression, Cre/Lox; Bacterial Resistance:Ampicillin
Defining Citation: PMID:17135424
Comments: Expresses Cre and GFP (driven by IRES)
Proper citation: RRID:Addgene_26646 Copy
Species: e. coli
Genetic Insert: pZE21-GFPaav
Vector Backbone Description: Backbone Size:2117; Vector Backbone:pZE21; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:10659856
Comments: Note that there are some discrepancies between Addgene's QC sequence and the depositor's sequence. These differences are not known to affect function.
Proper citation: RRID:Addgene_26643 Copy
Vector Backbone Description: Backbone Marker:Promega; Backbone Size:2743; Vector Backbone:pGEM-3Z; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:9514715
Comments: This plasmid contains a 147 bp nucleosome positioning sequence and is referred to as clone"603".
Please note that there may be discrepancies between Addgene's sequencing results and the depositor's sequence. Potential discrepancies are not a concern according to the depositing scientist because the clones were selected for their ability to bind to histone octamer, not for their specific sequence.
Proper citation: RRID:Addgene_26658 Copy
Species: Epstein-Barr Virus
Genetic Insert: Latent Membrane Protein 1
Vector Backbone Description: Backbone Size:4107; Vector Backbone:pSG5 (modified); Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:11387199
Proper citation: RRID:Addgene_26654 Copy
Species: Homo sapiens
Genetic Insert: β3-integrin
Vector Backbone Description: Backbone Size:4800; Vector Backbone:pYFP-N1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:11967230
Proper citation: RRID:Addgene_26653 Copy
Vector Backbone Description: Backbone Marker:Promega; Backbone Size:2743; Vector Backbone:pGEM-3Z; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:9514715
Comments: This plasmid contains a 147 bp nucleosome positioning sequence and is referred to as clone"601".
Primers that are used by the Widom lab to amplify the 147 bp fragment:
Forward:
ctggagaatcccggtgccg
Reverse:
acaggatgtatatatctgacacg
Please note that there may be discrepancies between Addgene's sequencing results and the depositor's sequence. Potential discrepancies are not a concern according to the depositing scientist because the clones were selected for their ability to bind to histone octamer, not for their specific sequence.
Proper citation: RRID:Addgene_26656 Copy
Vector Backbone Description: Backbone Marker:David Root; Backbone Size:7000; Vector Backbone:pLKO.1; Vector Types:Mammalian Expression, Lentiviral, RNAi; Bacterial Resistance:Ampicillin
Defining Citation: PMID:20890297
Proper citation: RRID:Addgene_26655 Copy
Species: Arabidopsis thaliana
Genetic Insert: iLOV
Vector Backbone Description: Backbone Marker:GE Healthcare; Backbone Size:4900; Vector Backbone:pGEX-4T-1; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19060199
Proper citation: RRID:Addgene_26587 Copy
Genetic Insert: Enhanced Green Fluorescent Protein
Vector Backbone Description: Backbone Size:7580; Vector Backbone:p156RRL-sinPPT-CMV-GFP-PRE/Nhe I; Vector Types:Mammalian Expression, Lentiviral, Tet-On Advanced vector; Bacterial Resistance:Ampicillin
Comments: Need to be transduced in a Tet-On Advanced cell line for expression of the GFP.
There are a few mismatches between Addgene's sequence and Dr Campeau's sequence. The sequence difference does not affect plasmid function.
Proper citation: RRID:Addgene_26584 Copy
Genetic Insert: Enhanced Green Fluorescent Protein
Vector Backbone Description: Backbone Size:8568; Vector Backbone:p156RRL-sinPPT-CMV-GFP-PRE/Nhe I; Vector Types:Mammalian Expression, Lentiviral, Tet-On Advanced vector; Bacterial Resistance:Ampicillin
Comments: Need to be transduced in a Tet-On Advanced cell line for expression of GFP.
There are a few mismatches between Addgene's sequence and Dr Campeau's sequence. The sequence differences do not affect GFP expression or general plasmid function.
Proper citation: RRID:Addgene_26585 Copy
Species: Multiple synthetic genes
Genetic Insert: Synthetic
Vector Backbone Description: Backbone Size:3288; Vector Backbone:pZS2; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:20646328
Proper citation: RRID:Addgene_26598 Copy
Species: Homo sapiens
Genetic Insert: raptor
Vector Backbone Description: Backbone Marker:Available at Addgene (#19319); Backbone Size:7400; Vector Backbone:pLJM1; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:20381137
Proper citation: RRID:Addgene_26633 Copy
Genetic Insert: control shRNA
Vector Backbone Description: Backbone Marker:System Biosciences; Backbone Size:7200; Vector Backbone:pSIH1-H1-puro; Vector Types:Lentiviral, RNAi; Bacterial Resistance:Ampicillin
Defining Citation: PMID:20197401
Comments: Control shRNA: AATAGCGACTAAACACATCAATTCAAGAGATTGATGTGTTTAGTCGCTATTTTTTTT
Proper citation: RRID:Addgene_26597 Copy
Species: Homo sapiens
Genetic Insert: STAT3 shRNA
Vector Backbone Description: Backbone Marker:System Biosciences; Backbone Size:7200; Vector Backbone:pSIH1-H1-puro; Vector Types:Lentiviral, RNAi; Bacterial Resistance:Ampicillin
Defining Citation: PMID:20197401
Comments: STAT3 shRNA sequence: gatccGCATCTGCCTAGATCGGCTATTCAAGAGATAGCCGATCTAGGCAGATGTTTTTTg
Proper citation: RRID:Addgene_26596 Copy
Species: X. albilineans
Genetic Insert: X. albilineans type I-F1 cas2-3
Vector Backbone Description: Vector Backbone:pET28b; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:35216669
Proper citation: RRID:Addgene_178769 Copy
Species: Homo sapiens
Genetic Insert: human rhinovirus 3C protease
Vector Backbone Description: Backbone Marker:Novagen; Vector Backbone:pET15b; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Proper citation: RRID:Addgene_178885 Copy
Species: X. albilineans
Genetic Insert: X. albilineans type I-C cas3
Vector Backbone Description: Vector Backbone:pET28b; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:35216669
Proper citation: RRID:Addgene_178766 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within RRID that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
