Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Mus musculus
Genetic Insert: Zfp521 promoter - 1 Kb
Vector Backbone Description: Backbone Size:4818; Vector Backbone:pGL3-Basic; Vector Types:Mammalian Expression, Luciferase; Bacterial Resistance:Ampicillin
Defining Citation: PMID:27506447
Comments: pGL3 backbone is a promoterless vector used for measuring the activity of inserted promoter sequences with a luciferase assay.
Primers used to clone 1Kb Zfp521 promoter:
Forward: cgtttaaaaactattttcttatccaga
Reverse: aatggaaaatccaagcaagg
Proper citation: RRID:Addgene_104188 Copy
Species: Mus musculus
Genetic Insert: ATE1
Vector Backbone Description: Vector Backbone:pH10UE; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Comments: Addgene NGS found plasmid contains Ate1 isoform 2 [NM_001271343.1].
Proper citation: RRID:Addgene_104339 Copy
Species: Mus musculus
Genetic Insert: Dopamine receptor D1 (Drd1)
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:4700; Vector Backbone:pEGFP-N; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:21152952
Proper citation: RRID:Addgene_104358 Copy
Species: Mus musculus
Genetic Insert: Kdm4b
Vector Backbone Description: Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:29089420
Proper citation: RRID:Addgene_104486 Copy
Species: Mus musculus
Genetic Insert: Nup37
Vector Backbone Description: Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24908396
Proper citation: RRID:Addgene_104562 Copy
Species: Mus musculus
Genetic Insert: Ran
Vector Backbone Description: Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24908396
Proper citation: RRID:Addgene_104560 Copy
Species: Mus musculus
Genetic Insert: UCP1 promoter
Vector Backbone Description: Backbone Marker:Origene; Vector Backbone:pCMV6-AC-GFP; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:28930673
Comments: The CMV promoter driving GFP expression was removed and replaced with the -5.5 kb mouse UCP1 promoter + Kozak
Reference sequence for promoter may be found here:
http://epd.vital-it.ch/cgi-bin/get_doc?db=mmEpdNew&format=genome&entry=Ucp1_1
Proper citation: RRID:Addgene_104585 Copy
Species: Mus musculus
Genetic Insert: Mouse IgG2c CH1/CH2/CH3
Vector Backbone Description: Backbone Marker:Invitrogen (Thermo Fisher); Backbone Size:10143; Vector Backbone:pCEP4; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:30196504
Comments: Addgene NGS results found A157G, A163G, A166G, and a 22 amino acid insertion of G and A residues within the G-A repeat region of EBNA-1 translation on the pCEP4 backbone compared to YP_401677.1.
Proper citation: RRID:Addgene_104580 Copy
Species: Mus musculus
Genetic Insert: gRNA and GFP donor
Vector Backbone Description: Vector Backbone:pOC2; Vector Types:CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:35851300
Comments: Please visit https://www.biorxiv.org/content/10.1101/2022.01.02.474730v1 for bioRxiv preprint.
Proper citation: RRID:Addgene_183430 Copy
Species: Mus musculus
Genetic Insert: gRNA and Halo donor
Vector Backbone Description: Vector Backbone:pOC2; Vector Types:CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:35851300
Comments: Please visit https://www.biorxiv.org/content/10.1101/2022.01.02.474730v1 for bioRxiv preprint.
Proper citation: RRID:Addgene_183449 Copy
Species: Mus musculus
Genetic Insert: Wnt10b
Vector Backbone Description: Backbone Size:3200; Vector Backbone:pCAGGS; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:9393971
Comments: See scanned map.
(Leder #C-893)
Proper citation: RRID:Addgene_1831 Copy
Species: Mus musculus
Genetic Insert: FBP30 WW-A
Vector Backbone Description: Backbone Marker:Amersham; Backbone Size:4969; Vector Backbone:pGEX-2TK; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:10744724
Comments: (Leder #C-1094)
Proper citation: RRID:Addgene_1845 Copy
Species: Mus musculus
Genetic Insert: FBP30 WW-A WW-B
Vector Backbone Description: Backbone Marker:Amersham; Backbone Size:4969; Vector Backbone:pGEX-2TK; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:10744724
Comments: (Leder #C-1096)
Proper citation: RRID:Addgene_1847 Copy
Species: Mus musculus
Genetic Insert: HIPK1
Vector Backbone Description: Backbone Size:5500; Vector Backbone:pcDNA3.1/myc-His; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:12529400
Comments: See scanned map.
(Leder #JE64)
Proper citation: RRID:Addgene_1850 Copy
Species: Mus musculus
Genetic Insert: eIF4E
Vector Backbone Description: Backbone Size:0; Vector Backbone:MSCV-IRES-GFP; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:15029198
Proper citation: RRID:Addgene_18761 Copy
Species: Mus musculus
Genetic Insert: eIF4E W73A
Vector Backbone Description: Backbone Size:0; Vector Backbone:MSCV-IRES-GFP; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:18055695
Proper citation: RRID:Addgene_18762 Copy
Species: Mus musculus
Genetic Insert: eIF4E S209D
Vector Backbone Description: Backbone Size:0; Vector Backbone:MSCV-IRES-GFP; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:18055695
Proper citation: RRID:Addgene_18765 Copy
Species: Mus musculus
Genetic Insert: Myc
Vector Backbone Description: Backbone Size:0; Vector Backbone:MSCV-IRES-GFP; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:16094360
Proper citation: RRID:Addgene_18770 Copy
Species: Mus musculus
Genetic Insert: thioredoxin-interacting protein promoter
Vector Backbone Description: Backbone Marker:Promega; Backbone Size:4818; Vector Backbone:pGL3-Basic; Vector Types:Luciferase; Bacterial Resistance:Ampicillin
Defining Citation: PMID:16301999
Proper citation: RRID:Addgene_18759 Copy
Species: Mus musculus
Genetic Insert: Sidekick-1
Vector Backbone Description: Backbone Marker:Stratagene; Backbone Size:4300; Vector Backbone:pCMV script; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:18216854
Comments: A Sidekick fragment was amplified from an IMAGE clone and inserted into pCMVscript. The sequence GGCCGCGGCATGGCCCGCGCCCGGCCCTCGGT GGCGGGCGGCGGAGTCGCGGCGCCCCCTGAGC GAGCGGGGCCCGGGC was then inserted 5' of this fragment to complete the open reading frame.
Proper citation: RRID:Addgene_18734 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within RRID that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.