Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Homo sapiens
Genetic Insert: EWSR1
Vector Backbone Description: Backbone Marker:N/A; Backbone Size:5421; Vector Backbone:pFRT_TO_DESTFLAGHA; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22081015
Proper citation: RRID:Addgene_26376 Copy
Species: Homo sapiens
Genetic Insert: EWSR1
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:2278; Vector Backbone:pENTR4; Vector Types:Gateway Cloning; Bacterial Resistance:Kanamycin
Defining Citation: PMID:22081015
Proper citation: RRID:Addgene_26372 Copy
Species: Caenorhabditis elegans
Genetic Insert: Pmyo-2::GFP::unc-54_3'UTR
Vector Backbone Description: Backbone Size:10813; Vector Backbone:pBCN27-R4R3; Vector Types:Worm Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:20729840
Comments: The full sequence provided is theoretical sequence based on a three way gateway reaction. The order of the elements has been confirmed by PCR, but not fully sequence verified. Expression pattern in worms is as expected.
Use this plasmid as a positive control for testing puromycin selection after single copy insertion by MosSCI at the ttTi5605 locus.
Proper citation: RRID:Addgene_26347 Copy
Species: Mus musculus
Genetic Insert: mmu-mir-1947
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:7711; Vector Backbone:pcDNA3.2/V5-DEST; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:20413612
Comments: pre-miRNA hairpins and the
surrounding regions were amplified from mouse BL6 genomic DNA using Pfu Polymerase and primers with Gateway (Invitrogen)- compatible ends designed to anneal about 100 nt upstream of and downstream from the miRNA hairpins. PCR products were inserted into Gateway vector pDONR221 and subsequently into pcDNA3.2/V5-DEST.
Proper citation: RRID:Addgene_26342 Copy
Species: Mus musculus
Genetic Insert: mmu-mir-1968
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:7711; Vector Backbone:pcDNA3.2/V5-DEST; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:20413612
Comments: pre-miRNA hairpins and the
surrounding regions were amplified from mouse BL6 genomic DNA using Pfu Polymerase and primers with Gateway (Invitrogen)- compatible ends designed to anneal about 100 nt upstream of and downstream from the miRNA hairpins. PCR products were inserted into Gateway vector pDONR221 and subsequently into pcDNA3.2/V5-DEST.
Proper citation: RRID:Addgene_26344 Copy
Species: Mus musculus
Genetic Insert: mmu-mir-1964
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:7711; Vector Backbone:pcDNA3.2/V5-DEST; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:20413612
Comments: pre-miRNA hairpins and the
surrounding regions were amplified from mouse BL6 genomic DNA using Pfu Polymerase and primers with Gateway (Invitrogen)- compatible ends designed to anneal about 100 nt upstream of and downstream from the miRNA hairpins. PCR products were inserted into Gateway vector pDONR221 and subsequently into pcDNA3.2/V5-DEST.
Proper citation: RRID:Addgene_26343 Copy
Species: Mus musculus
Genetic Insert: mmu-mir-1933
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:7711; Vector Backbone:pcDNA3.2/V5-DEST; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:20413612
Comments: pre-miRNA hairpins and the
surrounding regions were amplified from mouse BL6 genomic DNA using Pfu Polymerase and primers with Gateway (Invitrogen)- compatible ends designed to anneal about 100 nt upstream of and downstream from the miRNA hairpins. PCR products were inserted into Gateway vector pDONR221 and subsequently into pcDNA3.2/V5-DEST.
Proper citation: RRID:Addgene_26340 Copy
Species: Homo sapiens
Genetic Insert: lin-28 homolog B
Vector Backbone Description: Backbone Size:5169; Vector Backbone:pBabe.puro; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19483683
Proper citation: RRID:Addgene_26358 Copy
Species: Homo sapiens
Genetic Insert: Sox2 shRNA
Vector Backbone Description: Backbone Size:0; Vector Backbone:pLKO; Vector Types:Mammalian Expression, Lentiviral, RNAi; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19801978
Comments: SOX2a shRNA sequence - CGAGATAAACATGGCAATCAA
Proper citation: RRID:Addgene_26353 Copy
Species: Homo sapiens
Genetic Insert: Sox2 shRNA
Vector Backbone Description: Backbone Size:0; Vector Backbone:pLKO; Vector Types:Mammalian Expression, Lentiviral, RNAi; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19801978
Comments: SOX2b shRNA sequence - CTGCCGAGAATCCATGTATAT
Proper citation: RRID:Addgene_26352 Copy
Species: Homo sapiens
Genetic Insert: Sox2
Vector Backbone Description: Backbone Size:0; Vector Backbone:pWZL Blast; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19801978
Proper citation: RRID:Addgene_26351 Copy
Species: Homo sapiens
Genetic Insert: FOXE1
Vector Backbone Description: Backbone Marker:Addgene Plasmid 1764; Backbone Size:5169; Vector Backbone:pBabe-puro; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19801978
Proper citation: RRID:Addgene_26350 Copy
Species: Mus musculus
Genetic Insert: cytoplasmic dynein 1 intermediate chain 2 isoform F (exon 1a)
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:3931; Vector Backbone:pCR2.1-TOPO; Vector Types:subcloning and sequencing; Bacterial Resistance:Kanamycin
Defining Citation: PMID:20657784
Proper citation: RRID:Addgene_26448 Copy
Species: Mus musculus
Genetic Insert: cytoplasmic dynein 1 intermediate chain 2 isoform C (exon 1b)
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:3956; Vector Backbone:pCR4-TOPO; Vector Types:subcloning and sequencing; Bacterial Resistance:Kanamycin
Defining Citation: PMID:20657784
Proper citation: RRID:Addgene_26445 Copy
Species: Mus musculus
Genetic Insert: cytoplasmic dynein 1 intermediate chain 2 isoform B (exon 1a)
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:3931; Vector Backbone:pCR2.1-TOPO; Vector Types:subcloning and sequencing; Bacterial Resistance:Kanamycin
Defining Citation: PMID:20657784
Proper citation: RRID:Addgene_26447 Copy
Species: Mus musculus
Genetic Insert: cytoplasmic dynein 1 intermediate chain 1 isoform C
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:3956; Vector Backbone:pCR4-TOPO; Vector Types:subcloning and sequencing; Bacterial Resistance:Kanamycin
Defining Citation: PMID:20657784
Proper citation: RRID:Addgene_26440 Copy
Species: Mus musculus
Genetic Insert: cytoplasmic dynein 1 intermediate chain 2 isoform A (exon 1b)
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:3956; Vector Backbone:pCR4-TOPO; Vector Types:subcloning and sequencing; Bacterial Resistance:Kanamycin
Defining Citation: PMID:20657784
Proper citation: RRID:Addgene_26443 Copy
Species: Mus musculus
Genetic Insert: cytoplasmic dynein 1 intermediate chain 2 isoform E (exon 1b)
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:3956; Vector Backbone:pCR4-TOPO; Vector Types:subcloning and sequencing; Bacterial Resistance:Kanamycin
Defining Citation: PMID:20657784
Proper citation: RRID:Addgene_26442 Copy
Vector Backbone Description: Backbone Size:0; Vector Backbone:n/a; Vector Types:; Bacterial Resistance:Ampicillin and Streptomycin
Defining Citation: PMID:20621982
Comments: F- mcrA Δ(mrr-hsdRMS-mcrBC) Φ80dlacZ M15 ΔlacX74 deoR recA1 endA1 araD139 Δ(ara, leu) 7649 galU galK rspL nupG [ λcI857 (cro-bioA) < > bla]
Proper citation: RRID:Addgene_26452 Copy
Species: Mus musculus
Genetic Insert: cytoplasmic dynein light intermediate chain 1 N235Y
Vector Backbone Description: Backbone Marker:Stratagene; Backbone Size:4300; Vector Backbone:pSC-A-amp/kan; Vector Types:subcloning and sequencing; Bacterial Resistance:Kanamycin
Proper citation: RRID:Addgene_26451 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within RRID that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
