Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Preparing word cloud

×

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search
Reset search
Filter by records added date

See new records

Options

Current Facets and Filters

  • Mentions:yes (facet)

Facets

Recent searches

Snippet view Table view

Can't find the RRID you're searching for? X
Click the to add this resource to a Collection

32,424 Results - per page

Show More Columns | Download Top 1000 Results

Plasmid Name

Sort Ascending

Sort Descending

 Proper Citation

Sort Ascending

Sort Descending

 Insert Name

Sort Ascending

Sort Descending

 Organism

Sort Ascending

Sort Descending

 Bacterial Resistance

Sort Ascending

Sort Descending

 Defining Citation

Sort Ascending

Sort Descending

 Comments
Vector Backbone Description
Relevant Mutation
Record Last Update

Sort Ascending

Sort Descending

 Mentions Count

Sort Ascending

Sort Descending
pCMVTNT-T7-KPNA1
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_26677 Karyopherin Alpha 1 Homo sapiens Ampicillin PMID:20701745 S73N is a reported SNP in the KPNA1 sequence. For more information, please see: https://www.ncbi.nlm.nih.gov/projects/SNP/snp_ref.cgi?type=rs&rs=4678193 Backbone Marker:Promega; Backbone Size:4050; Vector Backbone:pCMVTNT; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin KPNA1 sequence contains a reported SNP at S73N 2026-09-01 09:51:44 7
pEGFP-C1-UBF
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_26672 UBF1 Homo sapiens Kanamycin PMID:11285283 Backbone Marker:Clontech; Backbone Size:4700; Vector Backbone:pEGFP-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin 2026-09-01 09:51:44 3
pEGFP-C1-Fibrillarin
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_26673 Fibrillarin Homo sapiens Kanamycin PMID:11285283 Backbone Marker:Clontech; Backbone Size:4700; Vector Backbone:pEGFP-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin 2026-09-01 09:51:44 7
pCAG-Cre-IRES2-GFP
 
Resource Report
Resource Website
10+ mentions 		RRID:Addgene_26646 Cre Bacteriophage P1 Ampicillin PMID:17135424 Expresses Cre and GFP (driven by IRES) Backbone Size:6000; Vector Backbone:pCAG-IRES2-GFP; Vector Types:Mammalian Expression, Cre/Lox; Bacterial Resistance:Ampicillin 2026-09-01 09:51:43 30
pZE21-GFPaav
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_26643 pZE21-GFPaav e. coli Kanamycin PMID:10659856 Note that there are some discrepancies between Addgene's QC sequence and the depositor's sequence. These differences are not known to affect function. Backbone Size:2117; Vector Backbone:pZE21; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin na 2026-09-01 09:51:43 1
pGEM-3z/603
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_26658 Ampicillin PMID:9514715 This plasmid contains a 147 bp nucleosome positioning sequence and is referred to as clone"603". Please note that there may be discrepancies between Addgene's sequencing results and the depositor's sequence. Potential discrepancies are not a concern according to the depositing scientist because the clones were selected for their ability to bind to histone octamer, not for their specific sequence. Backbone Marker:Promega; Backbone Size:2743; Vector Backbone:pGEM-3Z; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin 2026-09-01 09:51:43 4
p1990 SV40-LMP1
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_26654 Latent Membrane Protein 1 Epstein-Barr Virus Ampicillin PMID:11387199 Backbone Size:4107; Vector Backbone:pSG5 (modified); Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-09-01 09:51:43 2
β3-integrin-YFP
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_26653 β3-integrin Homo sapiens Kanamycin PMID:11967230 Backbone Size:4800; Vector Backbone:pYFP-N1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin 2026-09-01 09:51:43 3
pGEM-3z/601
 
Resource Report
Resource Website
10+ mentions 		RRID:Addgene_26656 Ampicillin PMID:9514715 This plasmid contains a 147 bp nucleosome positioning sequence and is referred to as clone"601". Primers that are used by the Widom lab to amplify the 147 bp fragment: Forward: ctggagaatcccggtgccg Reverse: acaggatgtatatatctgacacg Please note that there may be discrepancies between Addgene's sequencing results and the depositor's sequence. Potential discrepancies are not a concern according to the depositing scientist because the clones were selected for their ability to bind to histone octamer, not for their specific sequence. Backbone Marker:Promega; Backbone Size:2743; Vector Backbone:pGEM-3Z; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin 2026-09-01 09:51:43 23
pLKO.1-blast
 
Resource Report
Resource Website
50+ mentions 		RRID:Addgene_26655 Ampicillin PMID:20890297 Backbone Marker:David Root; Backbone Size:7000; Vector Backbone:pLKO.1; Vector Types:Mammalian Expression, Lentiviral, RNAi; Bacterial Resistance:Ampicillin 2026-09-01 09:51:43 87
pGEX iLOV
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_26587 iLOV Arabidopsis thaliana Ampicillin PMID:19060199 Backbone Marker:GE Healthcare; Backbone Size:4900; Vector Backbone:pGEX-4T-1; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin 2026-09-01 09:51:42 7
pLenti CMVtight eGFP Blast (w782-1)
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_26584 Enhanced Green Fluorescent Protein Ampicillin Need to be transduced in a Tet-On Advanced cell line for expression of the GFP. There are a few mismatches between Addgene's sequence and Dr Campeau's sequence. The sequence difference does not affect plasmid function. Backbone Size:7580; Vector Backbone:p156RRL-sinPPT-CMV-GFP-PRE/Nhe I; Vector Types:Mammalian Expression, Lentiviral, Tet-On Advanced vector; Bacterial Resistance:Ampicillin 2026-09-01 09:51:42 1
pLenti CMVtight eGFP Hygro (w783-1)
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_26585 Enhanced Green Fluorescent Protein Ampicillin Need to be transduced in a Tet-On Advanced cell line for expression of GFP. There are a few mismatches between Addgene's sequence and Dr Campeau's sequence. The sequence differences do not affect GFP expression or general plasmid function. Backbone Size:8568; Vector Backbone:p156RRL-sinPPT-CMV-GFP-PRE/Nhe I; Vector Types:Mammalian Expression, Lentiviral, Tet-On Advanced vector; Bacterial Resistance:Ampicillin 2026-09-01 09:51:42 2
pZS2-123
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_26598 Synthetic Multiple synthetic genes Kanamycin PMID:20646328 Backbone Size:3288; Vector Backbone:pZS2; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin N/A 2026-09-01 09:51:42 6
pLJM1 Flag Raptor
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_26633 raptor Homo sapiens Ampicillin PMID:20381137 Backbone Marker:Available at Addgene (#19319); Backbone Size:7400; Vector Backbone:pLJM1; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin 2026-09-01 09:51:43 9
pSIH1-puro-control shRNA
 
Resource Report
Resource Website
10+ mentions 		RRID:Addgene_26597 control shRNA Ampicillin PMID:20197401 Control shRNA: AATAGCGACTAAACACATCAATTCAAGAGATTGATGTGTTTAGTCGCTATTTTTTTT Backbone Marker:System Biosciences; Backbone Size:7200; Vector Backbone:pSIH1-H1-puro; Vector Types:Lentiviral, RNAi; Bacterial Resistance:Ampicillin 2026-09-01 09:51:42 18
pSIH1-puro-STAT3 shRNA
 
Resource Report
Resource Website
10+ mentions 		RRID:Addgene_26596 STAT3 shRNA Homo sapiens Ampicillin PMID:20197401 STAT3 shRNA sequence: gatccGCATCTGCCTAGATCGGCTATTCAAGAGATAGCCGATCTAGGCAGATGTTTTTTg Backbone Marker:System Biosciences; Backbone Size:7200; Vector Backbone:pSIH1-H1-puro; Vector Types:Lentiviral, RNAi; Bacterial Resistance:Ampicillin 2026-09-01 09:51:42 16
pXalb_IF1_Cas2-3
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_178769 X. albilineans type I-F1 cas2-3 X. albilineans Kanamycin PMID:35216669 Vector Backbone:pET28b; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin 2026-09-01 09:30:38 1
pHN924
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_178885 human rhinovirus 3C protease Homo sapiens Ampicillin Backbone Marker:Novagen; Vector Backbone:pET15b; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin 2026-09-01 09:30:40 2
pXalb_IC_Cas3
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_178766 X. albilineans type I-C cas3 X. albilineans Kanamycin PMID:35216669 Vector Backbone:pET28b; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin 2026-09-01 09:30:38 1

Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
X

  1. RRID Portal Resources

    Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search

  5. Collections

    If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  6. Facets

    Here are the facets that you can filter the data by.

  7. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

About

Welcome to the Resource Identification Portal Community.

Please see Force11 for more detailed information

We thank the NIH for their support of the RRID portal Award# R24GM144308, U24DK097771, U24DA039832, HHSN276201700124P, 75N97021P00135

Recent News Entries

Contact Us

Our Information

rii-help *at* scicrunch.org

About SciCrunch | Privacy Policy | Terms of Service

SciCrunch