Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Preparing word cloud

×

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search
Reset search
Filter by records added date

See new records

Options

Current Facets and Filters

  • Organism:mus musculus (facet)

Recent searches

Snippet view Table view

Can't find the RRID you're searching for? X
Click the to add this resource to a Collection

12,978 Results - per page

Show More Columns | Download Top 1000 Results

Plasmid Name

Sort Ascending

Sort Descending

 Proper Citation

Sort Ascending

Sort Descending

 Insert Name

Sort Ascending

Sort Descending

 Organism

Sort Ascending

Sort Descending

 Bacterial Resistance

Sort Ascending

Sort Descending

 Defining Citation

Sort Ascending

Sort Descending

 Comments
Vector Backbone Description
Relevant Mutation
Record Last Update

Sort Ascending

Sort Descending

 Mentions Count

Sort Ascending

Sort Descending
1kb Zfp521 promoter reporter
 
Resource Report
Resource Website 		RRID:Addgene_104188 Zfp521 promoter - 1 Kb Mus musculus Ampicillin PMID:27506447 pGL3 backbone is a promoterless vector used for measuring the activity of inserted promoter sequences with a luciferase assay. Primers used to clone 1Kb Zfp521 promoter: Forward: cgtttaaaaactattttcttatccaga Reverse: aatggaaaatccaagcaagg Backbone Size:4818; Vector Backbone:pGL3-Basic; Vector Types:Mammalian Expression, Luciferase; Bacterial Resistance:Ampicillin 2026-09-01 09:10:17 0
pCB410 (His-Ub-Ate1-4 1A7B)
 
Resource Report
Resource Website 		RRID:Addgene_104339 ATE1 Mus musculus Ampicillin Addgene NGS found plasmid contains Ate1 isoform 2 [NM_001271343.1]. Vector Backbone:pH10UE; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin 2026-09-01 09:10:20 0
pEGFP-N-Drd1
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_104358 Dopamine receptor D1 (Drd1) Mus musculus Kanamycin PMID:21152952 Backbone Marker:Clontech; Backbone Size:4700; Vector Backbone:pEGFP-N; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin 2026-09-01 09:10:20 2
pcDNA-Flag-Kdm4b-pA
 
Resource Report
Resource Website 		RRID:Addgene_104486 Kdm4b Mus musculus Ampicillin PMID:29089420 Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-09-01 09:10:22 0
pcDNA-Nup37-EGFP-polyA
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_104562 Nup37 Mus musculus Ampicillin PMID:24908396 Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-09-01 09:10:23 1
pcDNA-Ran-Q69L-mRFP1-polyA
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_104560 Ran Mus musculus Ampicillin PMID:24908396 Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin Q69L 2026-09-01 09:10:23 1
-5.5kb-UCP1-GFP
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_104585 UCP1 promoter Mus musculus Ampicillin PMID:28930673 The CMV promoter driving GFP expression was removed and replaced with the -5.5 kb mouse UCP1 promoter + Kozak Reference sequence for promoter may be found here: http://epd.vital-it.ch/cgi-bin/get_doc?db=mmEpdNew&format=genome&entry=Ucp1_1 Backbone Marker:Origene; Vector Backbone:pCMV6-AC-GFP; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-09-01 09:10:23 2
pRVL-2
 
Resource Report
Resource Website 		RRID:Addgene_104580 Mouse IgG2c CH1/CH2/CH3 Mus musculus Ampicillin PMID:30196504 Addgene NGS results found A157G, A163G, A166G, and a 22 amino acid insertion of G and A residues within the G-A repeat region of EBNA-1 translation on the pCEP4 backbone compared to YP_401677.1. Backbone Marker:Invitrogen (Thermo Fisher); Backbone Size:10143; Vector Backbone:pCEP4; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-09-01 09:10:23 0
pOC2 Gria1-GFP KI
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_183430 gRNA and GFP donor Mus musculus Ampicillin PMID:35851300 Please visit https://www.biorxiv.org/content/10.1101/2022.01.02.474730v1 for bioRxiv preprint. Vector Backbone:pOC2; Vector Types:CRISPR; Bacterial Resistance:Ampicillin 2026-09-01 09:31:38 1
pOC2 Dlg4-Halo KI
 
Resource Report
Resource Website 		RRID:Addgene_183449 gRNA and Halo donor Mus musculus Ampicillin PMID:35851300 Please visit https://www.biorxiv.org/content/10.1101/2022.01.02.474730v1 for bioRxiv preprint. Vector Backbone:pOC2; Vector Types:CRISPR; Bacterial Resistance:Ampicillin 2026-09-01 09:31:38 0
BA-Wnt10b
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_1831 Wnt10b Mus musculus Ampicillin PMID:9393971 See scanned map. (Leder #C-893) Backbone Size:3200; Vector Backbone:pCAGGS; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-09-01 09:31:32 2
GST-30A
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_1845 FBP30 WW-A Mus musculus Ampicillin PMID:10744724 (Leder #C-1094) Backbone Marker:Amersham; Backbone Size:4969; Vector Backbone:pGEX-2TK; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin 2026-09-01 09:31:55 1
GST-30A&B
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_1847 FBP30 WW-A WW-B Mus musculus Ampicillin PMID:10744724 (Leder #C-1096) Backbone Marker:Amersham; Backbone Size:4969; Vector Backbone:pGEX-2TK; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin 2026-09-01 09:31:59 1
HIPK1-myc-his
 
Resource Report
Resource Website 		RRID:Addgene_1850 HIPK1 Mus musculus Ampicillin PMID:12529400 See scanned map. (Leder #JE64) Backbone Size:5500; Vector Backbone:pcDNA3.1/myc-His; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-09-01 09:32:04 0
MSCV eIF4E IRES GFP
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_18761 eIF4E Mus musculus Ampicillin PMID:15029198 Backbone Size:0; Vector Backbone:MSCV-IRES-GFP; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin 2026-09-01 09:32:47 1
MSCV eIF4E W73A IRES GFP
 
Resource Report
Resource Website 		RRID:Addgene_18762 eIF4E W73A Mus musculus Ampicillin PMID:18055695 Backbone Size:0; Vector Backbone:MSCV-IRES-GFP; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin W73A 2026-09-01 09:32:47 0
MSCV eIF4E S209D IRES GFP
 
Resource Report
Resource Website 		RRID:Addgene_18765 eIF4E S209D Mus musculus Ampicillin PMID:18055695 Backbone Size:0; Vector Backbone:MSCV-IRES-GFP; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin S209D 2026-09-01 09:32:47 0
MSCV Myc IRES GFP
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_18770 Myc Mus musculus Ampicillin PMID:16094360 Backbone Size:0; Vector Backbone:MSCV-IRES-GFP; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin 2026-09-01 09:32:48 6
pGL3B-1081
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_18759 thioredoxin-interacting protein promoter Mus musculus Ampicillin PMID:16301999 Backbone Marker:Promega; Backbone Size:4818; Vector Backbone:pGL3-Basic; Vector Types:Luciferase; Bacterial Resistance:Ampicillin 2026-09-01 09:32:46 5
pCMV mouse sidekick1
 
Resource Report
Resource Website 		RRID:Addgene_18734 Sidekick-1 Mus musculus Kanamycin PMID:18216854 A Sidekick fragment was amplified from an IMAGE clone and inserted into pCMVscript. The sequence GGCCGCGGCATGGCCCGCGCCCGGCCCTCGGT GGCGGGCGGCGGAGTCGCGGCGCCCCCTGAGC GAGCGGGGCCCGGGC was then inserted 5' of this fragment to complete the open reading frame. Backbone Marker:Stratagene; Backbone Size:4300; Vector Backbone:pCMV script; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin 2026-09-01 09:32:43 0

Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
X

  1. RRID Portal Resources

    Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search

  5. Collections

    If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  6. Facets

    Here are the facets that you can filter the data by.

  7. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

About

Welcome to the Resource Identification Portal Community.

Please see Force11 for more detailed information

We thank the NIH for their support of the RRID portal Award# R24GM144308, U24DK097771, U24DA039832, HHSN276201700124P, 75N97021P00135

Recent News Entries

Contact Us

Our Information

rii-help *at* scicrunch.org

About SciCrunch | Privacy Policy | Terms of Service

SciCrunch