Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Mus musculus
Genetic Insert: Truncated Acetyl CoA Sythetase 2
Vector Backbone Description: Backbone Marker:Qiagen; Backbone Size:4700; Vector Backbone:pQE80; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:16790548
Proper citation: RRID:Addgene_13748 Copy
Species: Homo sapiens
Genetic Insert: HPV 16 E6 E7
Vector Backbone Description: Backbone Size:7500; Vector Backbone:pB-actin; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:2476573
Proper citation: RRID:Addgene_13718 Copy
Species: Homo sapiens
Genetic Insert: EGFP-Rac1(wt)
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5500; Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:11030651
Comments: Protocols for production and use of Hahn lab biosensors and photactivatable proteins
can be found on their web page, at the URL below. If you have
suggestions for the protocols or have any questions, please feel free to contact the Hahn
lab. Good luck with your experiments!
Hahn lab biosensor protocol: http://www.hahnlab.com/tools/index.html
Proper citation: RRID:Addgene_13719 Copy
Species: Homo sapiens
Genetic Insert: HPV 16 E6 E7
Vector Backbone Description: Backbone Size:7500; Vector Backbone:pB-actin; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:2476573
Proper citation: RRID:Addgene_13717 Copy
Species: Homo sapiens
Genetic Insert: EGFP-Rac1(Q61L)
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5500; Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:11030651
Comments: Protocols for production and use of Hahn lab biosensors and photactivatable proteins
can be found on their web page, at the URL below. If you have
suggestions for the protocols or have any questions, please feel free to contact the Hahn
lab. Good luck with your experiments!
Hahn lab biosensor protocol: http://www.hahnlab.com/tools/index.html
Proper citation: RRID:Addgene_13720 Copy
Species: Synthetic
Genetic Insert: Coff/Fon-sRGECO
Vector Backbone Description: Backbone Size:5300; Vector Backbone:AAV2-EF1a-WPRE; Vector Types:AAV, Cre/Lox, Synthetic Biology, Flp/FRT; Bacterial Resistance:Ampicillin
Defining Citation: PMID:32574559
Comments: Additional sequencing primers: Intron 1F GGGACGACATGACTTAACCAG; Intron 1R CCAGCCCTTCTCATGTTCAG
Proper citation: RRID:Addgene_137128 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: Signal recognition particle receptor β subunit
Vector Backbone Description: Backbone Size:5332; Vector Backbone:pET28a-derived; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:16627619
Proper citation: RRID:Addgene_13729 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: Signal recognition particle receptor β subunit
Vector Backbone Description: Backbone Size:5312; Vector Backbone:pET28a derived; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:16627619
Comments: Construct is expressed with a precission protease cleavable 6xHis tag
Proper citation: RRID:Addgene_13727 Copy
Species: Caenorhabditis elegans
Genetic Insert: Signal recognition particle receptor β subunit
Vector Backbone Description: Backbone Size:5317; Vector Backbone:pET28a-derived; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:16627619
Proper citation: RRID:Addgene_13728 Copy
Species: Bacteriophage P1
Genetic Insert: Cre-GFP fusion protein
Vector Backbone Description: Backbone Size:4779; Vector Backbone:pCAGEN; Vector Types:Mammalian Expression, Cre/Lox; Bacterial Resistance:Ampicillin
Defining Citation: PMID:17209010
Comments: Kozak consensus sequence was added before the start ATG.
GFP-tag was added at the C-terminus of Cre.
Cre-GFP fusion protein is localized in the cell nucleus.
Proper citation: RRID:Addgene_13776 Copy
Species: Homo sapiens
Genetic Insert: CALCOCO1 R12H
Vector Backbone Description: Vector Backbone:pCMV6-Entry; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:31971854
Proper citation: RRID:Addgene_137770 Copy
Species: Bacteriophage P1
Genetic Insert: Cre
Vector Backbone Description: Backbone Size:4779; Vector Backbone:pCAGEN; Vector Types:Mammalian Expression, Cre/Lox; Bacterial Resistance:Ampicillin
Defining Citation: PMID:17209010
Comments: Kozak consensus sequence was added before the start ATG.
Myc-tag was added at the C-terminus of Cre.
Proper citation: RRID:Addgene_13775 Copy
Species: Discosoma sp
Genetic Insert: DsRed2
Vector Backbone Description: Backbone Size:6061; Vector Backbone:pCAGEN; Vector Types:Mammalian Expression, Flp/FRT; Bacterial Resistance:Ampicillin
Defining Citation: PMID:17209010
Comments: Flp recombinase-dependent inducible expression vector. DsRed is expressed only in the presence of Flp.
Proper citation: RRID:Addgene_13771 Copy
Vector Backbone Description: Backbone Marker:Anna Behle; Vector Backbone:pSHDY; Vector Types:Bacterial Expression; Bacterial Resistance:Spectinomycin
Defining Citation: PMID:32134640
Comments: Please visit https://www.biorxiv.org/content/10.1101/757948v1 for bioRxiv preprint.
Proper citation: RRID:Addgene_137661 Copy
Species: HIV-1
Genetic Insert: HIV-1 Envelope Glycoprotein
Vector Backbone Description: Backbone Marker:Invitrogen; Vector Backbone: pcDNA3.1D/V5-His-TOPO; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:29020646
Comments: HIV-1 infected Patient Samples from Singapore, reverse transcribed RNA cloned into expression vector
Proper citation: RRID:Addgene_137669 Copy
Species: Rattus norvegicus
Genetic Insert: GRASP65
Vector Backbone Description: Vector Backbone:pEGFP-N2; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Proper citation: RRID:Addgene_137709 Copy
Species: Homo sapiens
Genetic Insert: Jnk2b2
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5446; Vector Backbone:pCDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:8654373
Proper citation: RRID:Addgene_13757 Copy
Species: Homo sapiens
Genetic Insert: Jnk2a1
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5446; Vector Backbone:pCDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:8654373
Proper citation: RRID:Addgene_13754 Copy
Species: HIV-1
Genetic Insert: HIV-1 Envelope Glycoprotein
Vector Backbone Description: Backbone Marker:Invitrogen; Vector Backbone: pcDNA3.1D/V5-His-TOPO; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:29020646
Comments: HIV-1 infected Patient Samples from Singapore, reverse transcribed RNA cloned into expression vector
Proper citation: RRID:Addgene_137671 Copy
Species: HIV-1
Genetic Insert: HIV-1 Envelope Glycoprotein
Vector Backbone Description: Backbone Marker:Invitrogen; Vector Backbone: pcDNA3.1D/V5-His-TOPO; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:29020646
Comments: HIV-1 infected Patient Samples from Singapore, reverse transcribed RNA cloned into expression vector
Proper citation: RRID:Addgene_137670 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within RRID that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
