Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Mus musculus
Genetic Insert: DscamL
Vector Backbone Description: Backbone Marker:Stratagene; Backbone Size:4300; Vector Backbone:pCMV script; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:18216854
Comments: A fragment of mouse Dscam-like-1 cDNA was amplified from the mKIAA1132 plasmid (Kazusa DNA Research Institute) using the following primers: GGCCGCGGCCGCCCGCACGGCCGGCCACAGGACCACC and CGCGGTCGACAGGTCCCAGTGTGGAGCCCTTCTCC. This fragment was cloned into the NotI/SalI sites of pCMVscript. To complete its open reading frame, a BglII fragment of this plasmid was replaced by a cDNA amplified from mouse brain using the following primers: GGCCAGATCTCCGCACGGCCGGCCACAGGACCACC and CGCGAGATCTGTTGCCGTTGTGCTTGAGGGAGAC.
Proper citation: RRID:Addgene_18738 Copy
Species: Mus musculus
Genetic Insert: TRPML2
Vector Backbone Description: Backbone Size:5500; Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:16606612
Proper citation: RRID:Addgene_18829 Copy
Species: Mus musculus
Genetic Insert: Type II transmembrane serine protease 6
Vector Backbone Description: Backbone Size:6265; Vector Backbone:p3xFLAG-CMV-14 (Sigma); Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:18451267
Proper citation: RRID:Addgene_18790 Copy
Species: Mus musculus
Genetic Insert: TRPML2
Vector Backbone Description: Backbone Size:5500; Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:16606612
Proper citation: RRID:Addgene_18828 Copy
Species: Mus musculus
Genetic Insert: Type II transmembrane serine protease 6
Vector Backbone Description: Backbone Size:6265; Vector Backbone:p3xFLAG-CMV-14; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:18451267
Proper citation: RRID:Addgene_18791 Copy
Species: Mus musculus
Genetic Insert: twist
Vector Backbone Description: Backbone Size:5100; Vector Backbone:pWZL-Blast; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:18485877
Comments: pWZL-Blast-Twist-ER was
generated by replacing the MYC cDNA of pWZL-Blast-DN-MycER
(Littlewood et al., 1995; Watnick et al., 2003) with the mTwist cDNA PCR amplified from pBp-mTwist.
Proper citation: RRID:Addgene_18799 Copy
Species: Mus musculus
Genetic Insert: TRPML3
Vector Backbone Description: Backbone Size:5500; Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:16606612
Proper citation: RRID:Addgene_18833 Copy
Species: Mus musculus
Genetic Insert: TRPML3
Vector Backbone Description: Backbone Size:5500; Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:16606612
Proper citation: RRID:Addgene_18835 Copy
Species: Mus musculus
Genetic Insert: amino acids 1-35 of the mitochondrial targeting sequence of ABCb10
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:4700; Vector Backbone:pEGFP N1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:15215243
Proper citation: RRID:Addgene_19035 Copy
Species: Mus musculus
Genetic Insert: amino acids 1 - 70 of the targeting sequence of ABCb1
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:4700; Vector Backbone:pEGFP N1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:15215243
Proper citation: RRID:Addgene_19038 Copy
Species: Mus musculus
Genetic Insert: ADAM10
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:7200; Vector Backbone:pQCXIP; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:17389606
Proper citation: RRID:Addgene_19137 Copy
Species: Mus musculus
Genetic Insert: TAZ
Vector Backbone Description: Vector Backbone:pGEX; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:14970209
Proper citation: RRID:Addgene_19024 Copy
Species: Mus musculus
Genetic Insert: TAZ
Vector Backbone Description: Backbone Size:5800; Vector Backbone:pEF-BOS; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:11118213
Comments: The murine TAZ cDNA was subcloned into pEF-BOS lacking the SV40 origin (Mizushima and Nagata, 1990) to generate pEF-TAZ. A Flag tag was inserted into the N-terminus of mTAZ cDNA by PCR, and cloned into pEF-BOS to create pEF-TAZ-N-Flag. The Murine TAZ(S89A) point mutant was constructed using the Transformer Site-Directed Mutagenesis Kit (Clontech).
Proper citation: RRID:Addgene_19026 Copy
Species: Mus musculus
Genetic Insert: Daxx myc
Vector Backbone Description: Backbone Size:4800; Vector Backbone:pCAGGS; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:12529400
Proper citation: RRID:Addgene_19281 Copy
Species: Mus musculus
Genetic Insert: Daxx
Vector Backbone Description: Backbone Size:4800; Vector Backbone:pCAGGS; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:12529400
Proper citation: RRID:Addgene_19283 Copy
Species: Mus musculus
Genetic Insert: Daxx myc S669A
Vector Backbone Description: Backbone Size:4800; Vector Backbone:pCAGGS; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:12529400
Proper citation: RRID:Addgene_19282 Copy
Species: Mus musculus
Genetic Insert: zeta globin
Vector Backbone Description: Backbone Size:3000; Vector Backbone:Sp64; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:6168916
Proper citation: RRID:Addgene_19262 Copy
Species: Mus musculus
Genetic Insert: GAL4
Vector Backbone Description: Backbone Size:7023; Vector Backbone:MMTV-SV40-Bssk; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:1846961
Proper citation: RRID:Addgene_19255 Copy
Species: Mus musculus
Genetic Insert: mKGFR (negative dominant)
Vector Backbone Description: Backbone Size:3000; Vector Backbone:BS KS+; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Proper citation: RRID:Addgene_19272 Copy
Species: Mus musculus
Genetic Insert: mouse Wrn cDNA
Vector Backbone Description: Backbone Size:5500; Vector Backbone:pCDNA3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Comments: Please note: Plasmid contains a F1400L mutation compared to the NCBI reference sequence AAF64490.1. This mutation is not known to affect plasmid function.
Proper citation: RRID:Addgene_19273 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within RRID that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
