Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Preparing word cloud

×

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search

Filter by records added date
See new records

Options


Current Facets and Filters

  • Authority:addgene (facet)

Facets


Recent searches

Snippet view Table view
Click the to add this resource to a Collection

178,636 Results - per page

Show More Columns | Download Top 1000 Results

Plasmid Name Proper Citation Insert Name Organism Bacterial Resistance Defining Citation Comments Vector Backbone Description Relevant Mutation Record Last Update Mentions Count
ACS2 Truncated
 
Resource Report
Resource Website
RRID:Addgene_13748 Truncated Acetyl CoA Sythetase 2 Mus musculus Ampicillin PMID:16790548 Backbone Marker:Qiagen; Backbone Size:4700; Vector Backbone:pQE80; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin Contains amino acids 39–682 2026-09-05 12:48:27 0
pB-actin E6, E7 TTL
 
Resource Report
Resource Website
RRID:Addgene_13718 HPV 16 E6 E7 Homo sapiens Ampicillin PMID:2476573 Backbone Size:7500; Vector Backbone:pB-actin; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin Translation termination linker at bp 711 of E7 so no expression. 2026-09-05 12:48:27 0
pcDNA3-EGFP-Rac1(wt)
 
Resource Report
Resource Website
10+ mentions
RRID:Addgene_13719 EGFP-Rac1(wt) Homo sapiens Ampicillin PMID:11030651 Protocols for production and use of Hahn lab biosensors and photactivatable proteins can be found on their web page, at the URL below. If you have suggestions for the protocols or have any questions, please feel free to contact the Hahn lab. Good luck with your experiments! Hahn lab biosensor protocol: http://www.hahnlab.com/tools/index.html Backbone Marker:Invitrogen; Backbone Size:5500; Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-09-05 12:48:27 14
pB-actin E6 TTL2, E7
 
Resource Report
Resource Website
RRID:Addgene_13717 HPV 16 E6 E7 Homo sapiens Ampicillin PMID:2476573 Backbone Size:7500; Vector Backbone:pB-actin; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin Translation termination linker at bp 280 of E6 so no expression. 2026-09-05 12:48:27 0
pcDNA3-EGFP-Rac1(Q61L)
 
Resource Report
Resource Website
10+ mentions
RRID:Addgene_13720 EGFP-Rac1(Q61L) Homo sapiens Ampicillin PMID:11030651 Protocols for production and use of Hahn lab biosensors and photactivatable proteins can be found on their web page, at the URL below. If you have suggestions for the protocols or have any questions, please feel free to contact the Hahn lab. Good luck with your experiments! Hahn lab biosensor protocol: http://www.hahnlab.com/tools/index.html Backbone Marker:Invitrogen; Backbone Size:5500; Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-09-05 12:48:27 13
pAAV-Ef1a-Coff/Fon-sRGECO
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_137128 Coff/Fon-sRGECO Synthetic Ampicillin PMID:32574559 Additional sequencing primers: Intron 1F GGGACGACATGACTTAACCAG; Intron 1R CCAGCCCTTCTCATGTTCAG Backbone Size:5300; Vector Backbone:AAV2-EF1a-WPRE; Vector Types:AAV, Cre/Lox, Synthetic Biology, Flp/FRT; Bacterial Resistance:Ampicillin E217D 2026-09-05 12:48:26 1
pScSR beta deltaN Flag
 
Resource Report
Resource Website
RRID:Addgene_13729 Signal recognition particle receptor β subunit Saccharomyces cerevisiae Kanamycin PMID:16627619 Backbone Size:5332; Vector Backbone:pET28a-derived; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin expresses residues 31-244 of S. cerevisiae SRβ with a thrombin protease cleavable N-terminal 6xHis tag and a C-terminal Flag tag 2026-09-05 12:48:27 0
pCpSRb-5
 
Resource Report
Resource Website
RRID:Addgene_13727 Signal recognition particle receptor β subunit Saccharomyces cerevisiae Kanamycin PMID:16627619 Construct is expressed with a precission protease cleavable 6xHis tag Backbone Size:5312; Vector Backbone:pET28a derived; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin SRβ circularly permuted D210E188 improved solubility from construct reported in paper 2026-09-05 12:48:27 0
pCeSR beta deltaN
 
Resource Report
Resource Website
RRID:Addgene_13728 Signal recognition particle receptor β subunit Caenorhabditis elegans Kanamycin PMID:16627619 Backbone Size:5317; Vector Backbone:pET28a-derived; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin expresses residues 38-240 of C. elegans SRβ with a precission protease cleavable N-terminal 6xHis tag 2026-09-05 12:48:27 0
pCAG-Cre:GFP
 
Resource Report
Resource Website
50+ mentions
RRID:Addgene_13776 Cre-GFP fusion protein Bacteriophage P1 Ampicillin PMID:17209010 Kozak consensus sequence was added before the start ATG. GFP-tag was added at the C-terminus of Cre. Cre-GFP fusion protein is localized in the cell nucleus. Backbone Size:4779; Vector Backbone:pCAGEN; Vector Types:Mammalian Expression, Cre/Lox; Bacterial Resistance:Ampicillin 2026-09-05 12:48:29 59
CALCOCO1 R12H-mycDDK
 
Resource Report
Resource Website
RRID:Addgene_137770 CALCOCO1 R12H Homo sapiens Kanamycin PMID:31971854 Vector Backbone:pCMV6-Entry; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin R12H 2026-09-05 12:48:29 0
pCAG-Cre
 
Resource Report
Resource Website
100+ mentions
RRID:Addgene_13775 Cre Bacteriophage P1 Ampicillin PMID:17209010 Kozak consensus sequence was added before the start ATG. Myc-tag was added at the C-terminus of Cre. Backbone Size:4779; Vector Backbone:pCAGEN; Vector Types:Mammalian Expression, Cre/Lox; Bacterial Resistance:Ampicillin 2026-09-05 12:48:28 126
pCAFNF-DsRed
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_13771 DsRed2 Discosoma sp Ampicillin PMID:17209010 Flp recombinase-dependent inducible expression vector. DsRed is expressed only in the presence of Flp. Backbone Size:6061; Vector Backbone:pCAGEN; Vector Types:Mammalian Expression, Flp/FRT; Bacterial Resistance:Ampicillin 2026-09-05 12:48:28 2
pSHDY
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_137661 Spectinomycin PMID:32134640 Please visit https://www.biorxiv.org/content/10.1101/757948v1 for bioRxiv preprint. Backbone Marker:Anna Behle; Vector Backbone:pSHDY; Vector Types:Bacterial Expression; Bacterial Resistance:Spectinomycin 2026-09-05 12:48:28 1
pHM073Env
 
Resource Report
Resource Website
RRID:Addgene_137669 HIV-1 Envelope Glycoprotein HIV-1 Ampicillin PMID:29020646 HIV-1 infected Patient Samples from Singapore, reverse transcribed RNA cloned into expression vector Backbone Marker:Invitrogen; Vector Backbone: pcDNA3.1D/V5-His-TOPO; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-09-05 12:48:28 0
pEGFP-N2-GRASP65
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_137709 GRASP65 Rattus norvegicus Kanamycin Vector Backbone:pEGFP-N2; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin 2026-09-05 12:48:28 2
pCDNA3 Flag Jnk2b2
 
Resource Report
Resource Website
RRID:Addgene_13757 Jnk2b2 Homo sapiens Ampicillin PMID:8654373 Backbone Marker:Invitrogen; Backbone Size:5446; Vector Backbone:pCDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-09-05 12:48:28 0
pCDNA3 Flag Jnk2a1
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_13754 Jnk2a1 Homo sapiens Ampicillin PMID:8654373 Backbone Marker:Invitrogen; Backbone Size:5446; Vector Backbone:pCDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-09-05 12:48:28 3
pHM153IEnv
 
Resource Report
Resource Website
RRID:Addgene_137671 HIV-1 Envelope Glycoprotein HIV-1 Ampicillin PMID:29020646 HIV-1 infected Patient Samples from Singapore, reverse transcribed RNA cloned into expression vector Backbone Marker:Invitrogen; Vector Backbone: pcDNA3.1D/V5-His-TOPO; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-09-05 12:48:28 0
pFREE019Env
 
Resource Report
Resource Website
RRID:Addgene_137670 HIV-1 Envelope Glycoprotein HIV-1 Ampicillin PMID:29020646 HIV-1 infected Patient Samples from Singapore, reverse transcribed RNA cloned into expression vector Backbone Marker:Invitrogen; Vector Backbone: pcDNA3.1D/V5-His-TOPO; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-09-05 12:48:28 0

Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
X
  1. RRID Portal Resources

    Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Collections

    If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  6. Facets

    Here are the facets that you can filter the data by.

  7. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.