Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
| Plasmid Name | Proper Citation | Insert Name | Organism | Bacterial Resistance | Defining Citation |
Comments |
||||
|---|---|---|---|---|---|---|---|---|---|---|
|
ACS2 Truncated Resource Report Resource Website |
RRID:Addgene_13748 | Truncated Acetyl CoA Sythetase 2 | Mus musculus | Ampicillin | PMID:16790548 | Backbone Marker:Qiagen; Backbone Size:4700; Vector Backbone:pQE80; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | Contains amino acids 39–682 | 2026-09-05 12:48:27 | 0 | |
|
pB-actin E6, E7 TTL Resource Report Resource Website |
RRID:Addgene_13718 | HPV 16 E6 E7 | Homo sapiens | Ampicillin | PMID:2476573 | Backbone Size:7500; Vector Backbone:pB-actin; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | Translation termination linker at bp 711 of E7 so no expression. | 2026-09-05 12:48:27 | 0 | |
|
pcDNA3-EGFP-Rac1(wt) Resource Report Resource Website 10+ mentions |
RRID:Addgene_13719 | EGFP-Rac1(wt) | Homo sapiens | Ampicillin | PMID:11030651 | Protocols for production and use of Hahn lab biosensors and photactivatable proteins can be found on their web page, at the URL below. If you have suggestions for the protocols or have any questions, please feel free to contact the Hahn lab. Good luck with your experiments! Hahn lab biosensor protocol: http://www.hahnlab.com/tools/index.html | Backbone Marker:Invitrogen; Backbone Size:5500; Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-09-05 12:48:27 | 14 | |
|
pB-actin E6 TTL2, E7 Resource Report Resource Website |
RRID:Addgene_13717 | HPV 16 E6 E7 | Homo sapiens | Ampicillin | PMID:2476573 | Backbone Size:7500; Vector Backbone:pB-actin; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | Translation termination linker at bp 280 of E6 so no expression. | 2026-09-05 12:48:27 | 0 | |
|
pcDNA3-EGFP-Rac1(Q61L) Resource Report Resource Website 10+ mentions |
RRID:Addgene_13720 | EGFP-Rac1(Q61L) | Homo sapiens | Ampicillin | PMID:11030651 | Protocols for production and use of Hahn lab biosensors and photactivatable proteins can be found on their web page, at the URL below. If you have suggestions for the protocols or have any questions, please feel free to contact the Hahn lab. Good luck with your experiments! Hahn lab biosensor protocol: http://www.hahnlab.com/tools/index.html | Backbone Marker:Invitrogen; Backbone Size:5500; Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-09-05 12:48:27 | 13 | |
|
pAAV-Ef1a-Coff/Fon-sRGECO Resource Report Resource Website 1+ mentions |
RRID:Addgene_137128 | Coff/Fon-sRGECO | Synthetic | Ampicillin | PMID:32574559 | Additional sequencing primers: Intron 1F GGGACGACATGACTTAACCAG; Intron 1R CCAGCCCTTCTCATGTTCAG | Backbone Size:5300; Vector Backbone:AAV2-EF1a-WPRE; Vector Types:AAV, Cre/Lox, Synthetic Biology, Flp/FRT; Bacterial Resistance:Ampicillin | E217D | 2026-09-05 12:48:26 | 1 |
|
pScSR beta deltaN Flag Resource Report Resource Website |
RRID:Addgene_13729 | Signal recognition particle receptor β subunit | Saccharomyces cerevisiae | Kanamycin | PMID:16627619 | Backbone Size:5332; Vector Backbone:pET28a-derived; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin | expresses residues 31-244 of S. cerevisiae SRβ with a thrombin protease cleavable N-terminal 6xHis tag and a C-terminal Flag tag | 2026-09-05 12:48:27 | 0 | |
|
pCpSRb-5 Resource Report Resource Website |
RRID:Addgene_13727 | Signal recognition particle receptor β subunit | Saccharomyces cerevisiae | Kanamycin | PMID:16627619 | Construct is expressed with a precission protease cleavable 6xHis tag | Backbone Size:5312; Vector Backbone:pET28a derived; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin | SRβ circularly permuted D210E188 improved solubility from construct reported in paper | 2026-09-05 12:48:27 | 0 |
|
pCeSR beta deltaN Resource Report Resource Website |
RRID:Addgene_13728 | Signal recognition particle receptor β subunit | Caenorhabditis elegans | Kanamycin | PMID:16627619 | Backbone Size:5317; Vector Backbone:pET28a-derived; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin | expresses residues 38-240 of C. elegans SRβ with a precission protease cleavable N-terminal 6xHis tag | 2026-09-05 12:48:27 | 0 | |
|
pCAG-Cre:GFP Resource Report Resource Website 50+ mentions |
RRID:Addgene_13776 | Cre-GFP fusion protein | Bacteriophage P1 | Ampicillin | PMID:17209010 | Kozak consensus sequence was added before the start ATG. GFP-tag was added at the C-terminus of Cre. Cre-GFP fusion protein is localized in the cell nucleus. | Backbone Size:4779; Vector Backbone:pCAGEN; Vector Types:Mammalian Expression, Cre/Lox; Bacterial Resistance:Ampicillin | 2026-09-05 12:48:29 | 59 | |
|
CALCOCO1 R12H-mycDDK Resource Report Resource Website |
RRID:Addgene_137770 | CALCOCO1 R12H | Homo sapiens | Kanamycin | PMID:31971854 | Vector Backbone:pCMV6-Entry; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin | R12H | 2026-09-05 12:48:29 | 0 | |
|
pCAG-Cre Resource Report Resource Website 100+ mentions |
RRID:Addgene_13775 | Cre | Bacteriophage P1 | Ampicillin | PMID:17209010 | Kozak consensus sequence was added before the start ATG. Myc-tag was added at the C-terminus of Cre. | Backbone Size:4779; Vector Backbone:pCAGEN; Vector Types:Mammalian Expression, Cre/Lox; Bacterial Resistance:Ampicillin | 2026-09-05 12:48:28 | 126 | |
|
pCAFNF-DsRed Resource Report Resource Website 1+ mentions |
RRID:Addgene_13771 | DsRed2 | Discosoma sp | Ampicillin | PMID:17209010 | Flp recombinase-dependent inducible expression vector. DsRed is expressed only in the presence of Flp. | Backbone Size:6061; Vector Backbone:pCAGEN; Vector Types:Mammalian Expression, Flp/FRT; Bacterial Resistance:Ampicillin | 2026-09-05 12:48:28 | 2 | |
|
pSHDY Resource Report Resource Website 1+ mentions |
RRID:Addgene_137661 | Spectinomycin | PMID:32134640 | Please visit https://www.biorxiv.org/content/10.1101/757948v1 for bioRxiv preprint. | Backbone Marker:Anna Behle; Vector Backbone:pSHDY; Vector Types:Bacterial Expression; Bacterial Resistance:Spectinomycin | 2026-09-05 12:48:28 | 1 | |||
|
pHM073Env Resource Report Resource Website |
RRID:Addgene_137669 | HIV-1 Envelope Glycoprotein | HIV-1 | Ampicillin | PMID:29020646 | HIV-1 infected Patient Samples from Singapore, reverse transcribed RNA cloned into expression vector | Backbone Marker:Invitrogen; Vector Backbone: pcDNA3.1D/V5-His-TOPO; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-09-05 12:48:28 | 0 | |
|
pEGFP-N2-GRASP65 Resource Report Resource Website 1+ mentions |
RRID:Addgene_137709 | GRASP65 | Rattus norvegicus | Kanamycin | Vector Backbone:pEGFP-N2; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin | 2026-09-05 12:48:28 | 2 | |||
|
pCDNA3 Flag Jnk2b2 Resource Report Resource Website |
RRID:Addgene_13757 | Jnk2b2 | Homo sapiens | Ampicillin | PMID:8654373 | Backbone Marker:Invitrogen; Backbone Size:5446; Vector Backbone:pCDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-09-05 12:48:28 | 0 | ||
|
pCDNA3 Flag Jnk2a1 Resource Report Resource Website 1+ mentions |
RRID:Addgene_13754 | Jnk2a1 | Homo sapiens | Ampicillin | PMID:8654373 | Backbone Marker:Invitrogen; Backbone Size:5446; Vector Backbone:pCDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-09-05 12:48:28 | 3 | ||
|
pHM153IEnv Resource Report Resource Website |
RRID:Addgene_137671 | HIV-1 Envelope Glycoprotein | HIV-1 | Ampicillin | PMID:29020646 | HIV-1 infected Patient Samples from Singapore, reverse transcribed RNA cloned into expression vector | Backbone Marker:Invitrogen; Vector Backbone: pcDNA3.1D/V5-His-TOPO; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-09-05 12:48:28 | 0 | |
|
pFREE019Env Resource Report Resource Website |
RRID:Addgene_137670 | HIV-1 Envelope Glycoprotein | HIV-1 | Ampicillin | PMID:29020646 | HIV-1 infected Patient Samples from Singapore, reverse transcribed RNA cloned into expression vector | Backbone Marker:Invitrogen; Vector Backbone: pcDNA3.1D/V5-His-TOPO; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-09-05 12:48:28 | 0 |
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
