Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
| Plasmid Name | Proper Citation | Insert Name | Organism | Bacterial Resistance | Defining Citation |
Comments |
||||
|---|---|---|---|---|---|---|---|---|---|---|
|
pCMV mouse Dscam-like Resource Report Resource Website 1+ mentions |
RRID:Addgene_18738 | DscamL | Mus musculus | Kanamycin | PMID:18216854 | A fragment of mouse Dscam-like-1 cDNA was amplified from the mKIAA1132 plasmid (Kazusa DNA Research Institute) using the following primers: GGCCGCGGCCGCCCGCACGGCCGGCCACAGGACCACC and CGCGGTCGACAGGTCCCAGTGTGGAGCCCTTCTCC. This fragment was cloned into the NotI/SalI sites of pCMVscript. To complete its open reading frame, a BglII fragment of this plasmid was replaced by a cDNA amplified from mouse brain using the following primers: GGCCAGATCTCCGCACGGCCGGCCACAGGACCACC and CGCGAGATCTGTTGCCGTTGTGCTTGAGGGAGAC. | Backbone Marker:Stratagene; Backbone Size:4300; Vector Backbone:pCMV script; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin | 2026-09-01 09:32:44 | 2 | |
|
TRPML2-MYC Resource Report Resource Website |
RRID:Addgene_18829 | TRPML2 | Mus musculus | Ampicillin | PMID:16606612 | Backbone Size:5500; Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-09-01 09:32:59 | 0 | ||
|
p3xFLAG-Tmprss6(Mask) Resource Report Resource Website |
RRID:Addgene_18790 | Type II transmembrane serine protease 6 | Mus musculus | Ampicillin | PMID:18451267 | Backbone Size:6265; Vector Backbone:p3xFLAG-CMV-14 (Sigma); Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | deleted amino acids 567-811 and replaced with 28 abberant amino acids. | 2026-09-01 09:32:51 | 0 | |
|
TRPML2-HA Resource Report Resource Website |
RRID:Addgene_18828 | TRPML2 | Mus musculus | Ampicillin | PMID:16606612 | Backbone Size:5500; Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-09-01 09:32:59 | 0 | ||
|
p3xFLAG-Tmprss6(S762A) Resource Report Resource Website 1+ mentions |
RRID:Addgene_18791 | Type II transmembrane serine protease 6 | Mus musculus | Ampicillin | PMID:18451267 | Backbone Size:6265; Vector Backbone:p3xFLAG-CMV-14; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | Changed Serine762 to Alanine | 2026-09-01 09:32:52 | 2 | |
|
pWZL Blast Twist ER Resource Report Resource Website 1+ mentions |
RRID:Addgene_18799 | twist | Mus musculus | Ampicillin | PMID:18485877 | pWZL-Blast-Twist-ER was generated by replacing the MYC cDNA of pWZL-Blast-DN-MycER (Littlewood et al., 1995; Watnick et al., 2003) with the mTwist cDNA PCR amplified from pBp-mTwist. | Backbone Size:5100; Vector Backbone:pWZL-Blast; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin | G525R mutation in the ER. The presence of the G525R point mutation in the cloned ER sequence abrogates its binding to 17β-estradiol while keeping its full sensitivity to the synthetic ligand 4'hydroxytamoxifen (4OHT) | 2026-09-01 09:32:53 | 8 |
|
TRPML3-MYC Resource Report Resource Website |
RRID:Addgene_18833 | TRPML3 | Mus musculus | Ampicillin | PMID:16606612 | Backbone Size:5500; Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-09-01 09:32:59 | 0 | ||
|
TRPML3-YFP Resource Report Resource Website |
RRID:Addgene_18835 | TRPML3 | Mus musculus | Ampicillin | PMID:16606612 | Backbone Size:5500; Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | Q165R, F210Y | 2026-09-01 09:33:00 | 0 | |
|
pABCb10aa1-35-GFP Resource Report Resource Website |
RRID:Addgene_19035 | amino acids 1-35 of the mitochondrial targeting sequence of ABCb10 | Mus musculus | Kanamycin | PMID:15215243 | Backbone Marker:Clontech; Backbone Size:4700; Vector Backbone:pEGFP N1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin | 2026-09-01 09:33:24 | 0 | ||
|
pABCb10aa1-70-GFP Resource Report Resource Website |
RRID:Addgene_19038 | amino acids 1 - 70 of the targeting sequence of ABCb1 | Mus musculus | Kanamycin | PMID:15215243 | Backbone Marker:Clontech; Backbone Size:4700; Vector Backbone:pEGFP N1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin | 2026-09-01 09:33:25 | 0 | ||
|
mADAM10 E385A in pQCXIP cFLAG Resource Report Resource Website 1+ mentions |
RRID:Addgene_19137 | ADAM10 | Mus musculus | Ampicillin | PMID:17389606 | Backbone Marker:Clontech; Backbone Size:7200; Vector Backbone:pQCXIP; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin | E385A | 2026-09-01 09:33:42 | 1 | |
|
GST-TAZ Resource Report Resource Website |
RRID:Addgene_19024 | TAZ | Mus musculus | Ampicillin | PMID:14970209 | Vector Backbone:pGEX; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | 2026-09-01 09:33:22 | 0 | ||
|
pEF-TAZ-N-Flag (S89A) Resource Report Resource Website 1+ mentions |
RRID:Addgene_19026 | TAZ | Mus musculus | Ampicillin | PMID:11118213 | The murine TAZ cDNA was subcloned into pEF-BOS lacking the SV40 origin (Mizushima and Nagata, 1990) to generate pEF-TAZ. A Flag tag was inserted into the N-terminus of mTAZ cDNA by PCR, and cloned into pEF-BOS to create pEF-TAZ-N-Flag. The Murine TAZ(S89A) point mutant was constructed using the Transformer Site-Directed Mutagenesis Kit (Clontech). | Backbone Size:5800; Vector Backbone:pEF-BOS; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | Vector has no SV40 origin, S89A (site directed mutagenesis) | 2026-09-01 09:33:23 | 4 |
|
pCAGGS/Daxx myc S502A Resource Report Resource Website |
RRID:Addgene_19281 | Daxx myc | Mus musculus | Ampicillin | PMID:12529400 | Backbone Size:4800; Vector Backbone:pCAGGS; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-09-01 09:34:04 | 0 | ||
|
pCAGGS/Daxx myc S502A/669A Resource Report Resource Website |
RRID:Addgene_19283 | Daxx | Mus musculus | Ampicillin | PMID:12529400 | Backbone Size:4800; Vector Backbone:pCAGGS; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-09-01 09:34:05 | 0 | ||
|
pCAGGS/Daxx myc S669A Resource Report Resource Website |
RRID:Addgene_19282 | Daxx myc S669A | Mus musculus | Ampicillin | PMID:12529400 | Backbone Size:4800; Vector Backbone:pCAGGS; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-09-01 09:34:04 | 0 | ||
|
Zeta-globin Resource Report Resource Website |
RRID:Addgene_19262 | zeta globin | Mus musculus | Ampicillin | PMID:6168916 | Backbone Size:3000; Vector Backbone:Sp64; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | 2026-09-01 09:34:02 | 0 | ||
|
MMTV-GAL4-SV40 Resource Report Resource Website |
RRID:Addgene_19255 | GAL4 | Mus musculus | Ampicillin | PMID:1846961 | Backbone Size:7023; Vector Backbone:MMTV-SV40-Bssk; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-09-01 09:34:01 | 0 | ||
|
mouse KGFR NEG D Resource Report Resource Website 1+ mentions |
RRID:Addgene_19272 | mKGFR (negative dominant) | Mus musculus | Ampicillin | Backbone Size:3000; Vector Backbone:BS KS+; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-09-01 09:34:03 | 1 | |||
|
pCMV WS Full Myc (Wrn cDNA) Resource Report Resource Website 1+ mentions |
RRID:Addgene_19273 | mouse Wrn cDNA | Mus musculus | Ampicillin | Please note: Plasmid contains a F1400L mutation compared to the NCBI reference sequence AAF64490.1. This mutation is not known to affect plasmid function. | Backbone Size:5500; Vector Backbone:pCDNA3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-09-01 09:34:03 | 1 |
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
