Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Synthetic
Genetic Insert: LoxP-SEC-LoxP
Vector Backbone Description: Vector Backbone:pDONR221; Vector Types:Worm Expression, Cre/Lox, CRISPR; Bacterial Resistance:Kanamycin
Defining Citation: PMID:32550377
Proper citation: RRID:Addgene_91829 Copy
Species: Synthetic
Genetic Insert: mScarlet-I-C1
Vector Backbone Description: Vector Backbone:pDONR221; Vector Types:Worm Expression, CRISPR; Bacterial Resistance:Kanamycin
Defining Citation: PMID:32550377
Proper citation: RRID:Addgene_91826 Copy
Species: Mus musculus
Genetic Insert: REST
Vector Backbone Description: Backbone Marker:David Root lab; Backbone Size:9396; Vector Backbone:pLIX_403; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Proper citation: RRID:Addgene_91896 Copy
Vector Backbone Description: Backbone Marker:Erik Jorgensen lab (Addgene #73715); Vector Backbone:pMLS256; Vector Types:Worm Expression, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:32550377
Comments: pMLS256 was modified by replacing the sgRNA scaffod with the "F+E" sgRNA and the sgRNA promoter with the one from pDD162.The sgRNA can be sequenced with primer ggtgtgaaataccgcacaga (same primer as used for pDD162).
Proper citation: RRID:Addgene_91834 Copy
Species: Synthetic
Genetic Insert: LwCas13a Guide site
Vector Backbone Description: Backbone Size:2850; Vector Backbone:pUC19; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:28976959
Proper citation: RRID:Addgene_91906 Copy
Species: Leptotrichia wadei
Genetic Insert: LwCas13a
Vector Backbone Description: Backbone Size:9204; Vector Backbone:lenti(AMP); Vector Types:Mammalian Expression, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:28976959
Proper citation: RRID:Addgene_91902 Copy
Species: Leptotrichia wadei
Genetic Insert: LwaCas13a
Vector Backbone Description: Backbone Marker:UC Berkeley Macrolab; Vector Backbone:p2CT; Vector Types:Bacterial Expression, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:28475872
Proper citation: RRID:Addgene_91865 Copy
Species: Other
Genetic Insert: LbuCas13a (LbuC2c2) R0179A/K1080A
Vector Backbone Description: Backbone Marker:UC Berkeley Macrolab; Vector Backbone:p2CT; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:28475872
Proper citation: RRID:Addgene_91861 Copy
Species: Homo sapiens
Genetic Insert: IL2RA CaRE4 scramble (plus strand)
Vector Backbone Description: Backbone Marker:Promega; Backbone Size:4283; Vector Backbone:pGL4.23; Vector Types:Mammalian Expression, Luciferase; Bacterial Resistance:Ampicillin
Defining Citation: PMID:28854172
Comments: Cloned from gBlock
Proper citation: RRID:Addgene_91852 Copy
Species: Homo sapiens
Genetic Insert: Erbb2
Vector Backbone Description: Backbone Marker:Tannishtha Reya (Addgene #20672); Vector Backbone:MSCV-IRES-GFP; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:28329683
Proper citation: RRID:Addgene_91888 Copy
Species: Homo sapiens
Genetic Insert: Vav2
Vector Backbone Description: Vector Backbone:pBABE; Vector Types:Mammalian Expression, Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:27980211
Proper citation: RRID:Addgene_91876 Copy
Species: Other
Genetic Insert: HheCas13a (HheC2c2) WT
Vector Backbone Description: Backbone Marker:UC Berkeley Macrolab; Vector Backbone:p2CT; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:28475872
Proper citation: RRID:Addgene_91871 Copy
Species: Leptotrichia wadei
Genetic Insert: LwCas13a and guide expression cassette
Vector Backbone Description: Backbone Size:4197; Vector Backbone:pACYC184; Vector Types:Bacterial Expression, CRISPR; Bacterial Resistance:Chloramphenicol
Defining Citation: PMID:28976959
Proper citation: RRID:Addgene_91909 Copy
Species: Synthetic
Genetic Insert: EGFP
Vector Backbone Description: Backbone Marker:K. Deisseroth Lab (Addgene #37084); Backbone Size:6342; Vector Backbone:pAAV-Ef1a-DIO-EGFP-WPRE-pA; Vector Types:AAV; Bacterial Resistance:Ampicillin
Defining Citation: PMID:28888955
Proper citation: RRID:Addgene_91946 Copy
Species: Homo sapiens
Genetic Insert: CSNK1A1
Vector Backbone Description: Backbone Marker:Connie Cepko Lab (Addgene #11159); Vector Backbone:pCAGIG; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:28114302
Proper citation: RRID:Addgene_92014 Copy
Vector Backbone Description: Backbone Size:5552; Vector Backbone:pCDB179; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Proper citation: RRID:Addgene_91960 Copy
Vector Backbone Description: Backbone Marker:Connie Cepko Lab (Addgene #11159); Vector Backbone:pCAGIG; Vector Types:Mammalian Expression; Bacterial Resistance:Chloramphenicol and Ampicillin
Defining Citation: PMID:28114302
Proper citation: RRID:Addgene_92015 Copy
Species: Synthetic
Genetic Insert: MTS-mCherry-GFP1-10
Vector Backbone Description: Backbone Marker:PMID: 7737504; Vector Backbone:p404TDH3; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:28241148
Comments: The MTS sequence is based on subunit 9 of F0-ATP synthase (pOLI1-HcRed) from Curr Biol. 2004 Nov 23;14(22):1996-2004
Proper citation: RRID:Addgene_91958 Copy
Vector Backbone Description: Backbone Size:7659; Vector Backbone:pCDB24; Vector Types:Bacterial Expression, Yeast Expression; Bacterial Resistance:Ampicillin
Proper citation: RRID:Addgene_91959 Copy
Species: Synthetic
Genetic Insert: MTS-mCherry-GFP1-10
Vector Backbone Description: Backbone Marker:Clontech; Vector Backbone:pDsRed-Monomer-Hyg-N1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:28241148
Comments: The MTS sequence is based on subunit 9 of F0-ATP synthase (pOLI1-HcRed) from Curr Biol. 2004 Nov 23;14(22):1996-2004
Proper citation: RRID:Addgene_91957 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within RRID that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
