Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: E. Coli
Genetic Insert: FLIPglu-600μΔ13V
Vector Backbone Description: Backbone Size:6866; Vector Backbone:pDRf1GW-ura3; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:20854260
Proper citation: RRID:Addgene_28001 Copy
Species: Danio rerio
Genetic Insert: Zinc finger array targeting NRF2b (nfe212b)
Vector Backbone Description: Backbone Size:5493; Vector Backbone:MG414; Vector Types:Zebrafish Targeting; Bacterial Resistance:Kanamycin
Defining Citation: PMID:18657511
Comments: This plasmid encodes a zinc finger array targeting half of a target sequence in the zebrafish gene NRF2b (nfe212b) (see below). Please note that this plasmid does NOT contain the NRF2b (nfe212b) sequence.
Users must order the complementary plasmid NRF2b (nfe212b)_L (OZ561) [Addgene plasmid 28086] in order to create a zinc finger nuclease (ZFN) pair to introduce targeted mutations into this specific zebrafish gene.
Users will also need to clone the zinc finger (ZF) insert of this plasmid into a zinc finger nuclease (ZFN) vector to express a FOKI fusion product. Examples of possible ZFN expression vectors that can be used are: pST1374 (Addgene plasmid 13426), pMLM290 (Addgene plasmid 21872), pMLM292 (Addgene plasmid 21873), pMLM800 (Addgene plasmid 27202) and pMLM802 (Addgene plasmid 27203).
This zinc finger array was tested for binding activity to the sequence 5'-GAGGAGGAG-3' in a bacterial two hybrid assay, and resulted in 4.34 fold activation. However, this array has not yet been tested for activity as a zinc finger nuclease (i.e. for its ability to induce mutations at the intended locus).
Scientists using this zinc finger array in a publication should notify [email protected] and acknowledge NIH grant number R01 GM088040 in the publication.
Other Articles: "Oligomerized pool engineering (OPEN): an 'open-source' protocol for making customized zinc-finger arrays." Maeder ML et al. (Nat Protoc. 2009 Sept 17. 4(10):1471-1501. Pubmed ID: 19798082
"Targeted mutagenesis in zebrafish using customized zinc-finger nucleases." Foley JE et al. (Nat Protoc. 2009 Dec 3. 4(12):1855-1867. Pubmed ID: 20010934
Proper citation: RRID:Addgene_28087 Copy
Vector Backbone Description: Backbone Size:5633; Vector Backbone:pEF1a-Luc-IRES-Neo; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:20581084
Proper citation: RRID:Addgene_28019 Copy
Species: Synthetic, T7 phage
Genetic Insert: EYFP-fuse, T7 RNAP
Vector Backbone Description: Backbone Marker:Clonetech; Backbone Size:2500; Vector Backbone:pProlar.A122; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:19801994
Proper citation: RRID:Addgene_28013 Copy
Species: T7 phage
Genetic Insert: T7 RNAP
Vector Backbone Description: Backbone Marker:Novagen; Backbone Size:6000; Vector Backbone:pET15b; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19801994
Proper citation: RRID:Addgene_28012 Copy
Species: Homo sapiens
Genetic Insert: mitofusin 2
Vector Backbone Description: Backbone Size:4700; Vector Backbone:YFP-N1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:12499352
Comments: Santel, A. and M.T. Fuller, Control of mitochondrial morphology by a human mitofusin. J Cell Sci, 2001. 114(Pt 5): p. 867-74.
Proper citation: RRID:Addgene_28010 Copy
Species: Homo sapiens
Genetic Insert: Tar DNA binding protein
Vector Backbone Description: Backbone Marker:Clontech Laboratories, Inc; Backbone Size:4694; Vector Backbone:pEGFP-N1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:21209826
Proper citation: RRID:Addgene_28195 Copy
Species: Human Merkel Cell polyomavirus
Genetic Insert: MCV replication region
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:3900; Vector Backbone:pCR2.1-TOPO; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin and Kanamycin
Defining Citation: PMID:18812503
Proper citation: RRID:Addgene_28192 Copy
Species: Homo sapiens
Genetic Insert: FGD5:HPC09X-H08:C212499
Vector Backbone Description: Backbone Marker:SGC; Backbone Size:7325; Vector Backbone:pET28-MHL (Addgene plasmid 26096); Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Comments: PDB: 3MPX.
http://www.thesgc.org/structures/3MPX/
Proper citation: RRID:Addgene_28109 Copy
Species: Homo sapiens
Genetic Insert: BRPF1:JMC014-E01:C44383
Vector Backbone Description: Backbone Marker:SGC; Backbone Size:7325; Vector Backbone:pET28-MHL (Addgene plasmid 26096); Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Comments: PDB: 3MO8. https://www.thesgc.org/structures/3MO8/
PDB: 5C6S. https://www.thesgc.org/structures/5C6S
Note that this clone is the same as PDB IDs 3MO8 and 5C6S
Proper citation: RRID:Addgene_28107 Copy
Species: Homo sapiens
Genetic Insert: WIP1
Vector Backbone Description: Backbone Size:7767; Vector Backbone:pCMV-Neo-Bam; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:20118229
Proper citation: RRID:Addgene_28106 Copy
Species: Human Merkel Cell polyomavirus
Genetic Insert: MCPyV Large T antigen (206 wild-type strain)
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5100; Vector Backbone:pcDNA6/V5-His B; Vector Types:Mammalian Expression, Bacterial Expression; Bacterial Resistance:Ampicillin
Proper citation: RRID:Addgene_28189 Copy
Species: Mus musculus
Genetic Insert: Nr5a1 shRNA
Vector Backbone Description: Backbone Marker:Genscript; Backbone Size:6478; Vector Backbone:pRNAT-CMV3.1/Neo; Vector Types:Mammalian Expression, RNAi; Bacterial Resistance:Ampicillin
Defining Citation: PMID:18388192
Comments: shRNA #3 sequence: GATCCTCAATGAGAAGGTTGTTGCGGTTGATATCCGCCGCAACAACCTTCTCATTGACGC
Proper citation: RRID:Addgene_28188 Copy
Species: Homo sapiens
Genetic Insert: CYP11A1:HPC09N-C05:C214491
Vector Backbone Description: Backbone Marker:SGC; Backbone Size:6980; Vector Backbone:pCW-LIC (Addgene plasmid 26098); Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Comments: PDB: 3N9Y. http://www.thesgc.org/structures/3N9Y/
Human CYP11A1 fused with a portion of its cognate redox partner, ferredoxin. The CYP11A1 insert in this plasmid does not contain amino acids a1-40 of GenBank reference sequence NP_000772.2.
Proper citation: RRID:Addgene_28119 Copy
Species: Plasmodium falciparum
Genetic Insert: PF07_0029:MAC03H-B04:C212662
Vector Backbone Description: Backbone Marker:SGC; Backbone Size:7737; Vector Backbone:pET15-MHL (Addgene plasmid 26092); Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Comments: PDB: 3N72. http://www.thesgc.org/structures/3N72/
Proper citation: RRID:Addgene_28116 Copy
Species: Plasmodium berghei
Genetic Insert: PBG-PF11_0147
Vector Backbone Description: Backbone Marker:SGC; Backbone Size:7737; Vector Backbone:pET15-MHL (Addgene plasmid 26092); Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Comments: PDB: 3N9X. http://www.thesgc.org/structures/3N9X/
Proper citation: RRID:Addgene_28117 Copy
Species: Homo sapiens
Genetic Insert: SUV39H1
Vector Backbone Description: Backbone Marker:SGC; Backbone Size:7325; Vector Backbone:pET28-MHL (Addgene plasmid 26096); Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Comments: PDB 3MTS: http://www.thesgc.org/structures/3MTS/
Proper citation: RRID:Addgene_28113 Copy
Species: Homo sapiens
Genetic Insert: Tar DNA binding protein
Vector Backbone Description: Backbone Marker:Clontech Laboratories, Inc; Backbone Size:4694; Vector Backbone:pEGFP-N1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:21209826
Proper citation: RRID:Addgene_28198 Copy
Species: Plasmodium falciparum
Genetic Insert: PF11_0239:MAC03B-G02:C205882
Vector Backbone Description: Backbone Marker:SGC; Backbone Size:7737; Vector Backbone:pET15-MHL (Addgene plasmid 26092); Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Comments: PDB: 3MSE. http://www.thesgc.org/structures/3MSE/
Proper citation: RRID:Addgene_28111 Copy
Species: synthetic gene fragment
Genetic Insert: Tetrahymena TERT
Vector Backbone Description: Backbone Size:5700; Vector Backbone:pET21; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:15731105
Proper citation: RRID:Addgene_28172 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within RRID that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
