Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
| Plasmid Name | Proper Citation | Insert Name | Organism | Bacterial Resistance | Defining Citation |
Comments |
||||
|---|---|---|---|---|---|---|---|---|---|---|
|
pDP-let-7_wt Resource Report Resource Website |
RRID:Addgene_26558 | cel-pre-let-7 | Caenorhabditis elegans | Ampicillin | PMID:20808284 | This construct does not produce perfect pre-let-7. There are leader and tail sequences from the backbone MCS. Loop mutants have also all been cloned into this backbone for in vitro translation. | Backbone Marker:Ambion; Backbone Size:2700; Vector Backbone:pDP19; Vector Types:transcription vector; Bacterial Resistance:Ampicillin | 2026-08-29 01:03:08 | 0 | |
|
pT/HB Resource Report Resource Website |
RRID:Addgene_26555 | pT/HB | Ampicillin | There are three mismatches between Addgene and author sequence but they are in vector backbone. | Backbone Marker:Stratagene; Backbone Size:2914; Vector Backbone:pBluescript; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | 2026-08-29 01:03:08 | 0 | |||
|
pEGFP-C1-TFIIB Resource Report Resource Website 1+ mentions |
RRID:Addgene_26675 | TFIIB | Homo sapiens | Kanamycin | PMID:11809839 | Backbone Marker:Clontech; Backbone Size:4700; Vector Backbone:pEGFP-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin | 2026-08-29 01:03:09 | 1 | ||
|
pT2/HB Resource Report Resource Website 10+ mentions |
RRID:Addgene_26557 | pT2/HB | Ampicillin | Backbone Marker:Stratagene; Backbone Size:2918; Vector Backbone:pBluescript; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | 2026-08-29 01:03:08 | 27 | ||||
|
pT2/BH Resource Report Resource Website 10+ mentions |
RRID:Addgene_26556 | pT2/BH | Ampicillin | Backbone Marker:Stratagene; Backbone Size:2918; Vector Backbone:pBluescript; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | 2026-08-29 01:03:08 | 18 | ||||
|
pEGFP-C1-UBF Resource Report Resource Website 1+ mentions |
RRID:Addgene_26672 | UBF1 | Homo sapiens | Kanamycin | PMID:11285283 | Backbone Marker:Clontech; Backbone Size:4700; Vector Backbone:pEGFP-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin | 2026-08-29 01:03:09 | 3 | ||
|
FSynIGW2 Resource Report Resource Website |
RRID:Addgene_26671 | Ampicillin | The vector has neuron specific promoter with downstream IRES2-EGFP sequence which allow the fluorescence marker protein to be expressed in a lower level under the same promoter with the transgene. | Backbone Size:10471; Vector Backbone:FSynIGW2; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin | 2026-08-29 01:03:09 | 0 | ||||
|
pEGFP-C1-Fibrillarin Resource Report Resource Website 1+ mentions |
RRID:Addgene_26673 | Fibrillarin | Homo sapiens | Kanamycin | PMID:11285283 | Backbone Marker:Clontech; Backbone Size:4700; Vector Backbone:pEGFP-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin | 2026-08-29 01:03:09 | 7 | ||
|
pCAG-Cre-IRES2-GFP Resource Report Resource Website 10+ mentions |
RRID:Addgene_26646 | Cre | Bacteriophage P1 | Ampicillin | PMID:17135424 | Expresses Cre and GFP (driven by IRES) | Backbone Size:6000; Vector Backbone:pCAG-IRES2-GFP; Vector Types:Mammalian Expression, Cre/Lox; Bacterial Resistance:Ampicillin | 2026-08-29 01:03:09 | 30 | |
|
p1553 CMV-EBNA1 (delta GGA) Resource Report Resource Website |
RRID:Addgene_26648 | Epstein-Barr Nuclear Antigen 1 | Epstein-Barr Virus | Ampicillin | PMID:9830062 | This plasmid expresses delta 205 GGA EBNA-1 driven by the CMV IE promoter. | Backbone Size:5718; Vector Backbone:modified pHyg; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | deletion of 224 amino acids of EBNA-1 (aa101-324 when compared to P03211.1) | 2026-08-29 01:03:09 | 0 |
|
pZE21-GFPaav Resource Report Resource Website 1+ mentions |
RRID:Addgene_26643 | pZE21-GFPaav | e. coli | Kanamycin | PMID:10659856 | Note that there are some discrepancies between Addgene's QC sequence and the depositor's sequence. These differences are not known to affect function. | Backbone Size:2117; Vector Backbone:pZE21; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin | na | 2026-08-29 01:03:09 | 1 |
|
pET21b Apaf1 1-591 Resource Report Resource Website |
RRID:Addgene_26642 | Apoptotic protease activating factor 1 | Homo sapiens | Ampicillin | PMID:16630894 | Backbone Marker:Novagen; Backbone Size:5443; Vector Backbone:pET21b; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | Amino Acids 1-591 | 2026-08-29 01:03:09 | 0 | |
|
PCDNA-Δ90AEGFP Resource Report Resource Website |
RRID:Addgene_26644 | Δ90beta catenin | Mus musculus | Ampicillin | Δ90AEGFP is Δ90betacatenin fused with EGFP-mut4 from Ami Okada | Backbone Marker:Invitrogen; Backbone Size:5400; Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | Deletion of first 90 aa of beta catenin | 2026-08-29 01:03:09 | 0 | |
|
pET21a IHF Resource Report Resource Website |
RRID:Addgene_26641 | IHF | Ampicillin | Use Rosetta(DE3)plysS cells for expression. Please note that the IHF insert is NOT expressed with a His tag. | Backbone Marker:EMD Biosciences; Backbone Size:5443; Vector Backbone:pET21a; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | 2026-08-29 01:03:09 | 0 | |||
|
pGEM-3z/603 Resource Report Resource Website 1+ mentions |
RRID:Addgene_26658 | Ampicillin | PMID:9514715 | This plasmid contains a 147 bp nucleosome positioning sequence and is referred to as clone"603". Please note that there may be discrepancies between Addgene's sequencing results and the depositor's sequence. Potential discrepancies are not a concern according to the depositing scientist because the clones were selected for their ability to bind to histone octamer, not for their specific sequence. | Backbone Marker:Promega; Backbone Size:2743; Vector Backbone:pGEM-3Z; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | 2026-08-29 01:03:09 | 4 | |||
|
pGEM-3z/602 Resource Report Resource Website |
RRID:Addgene_26657 | Ampicillin | PMID:9514715 | This plasmid contains a 147 bp nucleosome positioning sequence and is referred to as clone"602". Please note that there may be discrepancies between Addgene's sequencing results and the depositor's sequence. Potential discrepancies are not a concern according to the depositing scientist because the clones were selected for their ability to bind to histone octamer, not for their specific sequence. | Backbone Marker:Promega; Backbone Size:2743; Vector Backbone:pGEM-3Z; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | 2026-08-29 01:03:09 | 0 | |||
|
pGEM-3z/605 Resource Report Resource Website |
RRID:Addgene_26659 | Ampicillin | PMID:9514715 | This plasmid contains a 147 bp nucleosome positioning sequence and is referred to as clone"605". Please note that there may be discrepancies between Addgene's sequencing results and the depositor's sequence. Potential discrepancies are not a concern according to the depositing scientist because the clones were selected for their ability to bind to histone octamer, not for their specific sequence. | Backbone Marker:Promega; Backbone Size:2743; Vector Backbone:pGEM-3Z; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | 2026-08-29 01:03:09 | 0 | |||
|
p1990 SV40-LMP1 Resource Report Resource Website 1+ mentions |
RRID:Addgene_26654 | Latent Membrane Protein 1 | Epstein-Barr Virus | Ampicillin | PMID:11387199 | Backbone Size:4107; Vector Backbone:pSG5 (modified); Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-29 01:03:09 | 2 | ||
|
β3-integrin-YFP Resource Report Resource Website 1+ mentions |
RRID:Addgene_26653 | β3-integrin | Homo sapiens | Kanamycin | PMID:11967230 | Backbone Size:4800; Vector Backbone:pYFP-N1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin | 2026-08-29 01:03:09 | 3 | ||
|
pGEM-3z/601 Resource Report Resource Website 10+ mentions |
RRID:Addgene_26656 | Ampicillin | PMID:9514715 | This plasmid contains a 147 bp nucleosome positioning sequence and is referred to as clone"601". Primers that are used by the Widom lab to amplify the 147 bp fragment: Forward: ctggagaatcccggtgccg Reverse: acaggatgtatatatctgacacg Please note that there may be discrepancies between Addgene's sequencing results and the depositor's sequence. Potential discrepancies are not a concern according to the depositing scientist because the clones were selected for their ability to bind to histone octamer, not for their specific sequence. | Backbone Marker:Promega; Backbone Size:2743; Vector Backbone:pGEM-3Z; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | 2026-08-29 01:03:09 | 23 |
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
