Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Mus musculus
Genetic Insert: pAAV CAG iGluSnFR3 v857.SGZ
Vector Backbone Description: Backbone Size:4852; Vector Backbone:pAAV CAG; Vector Types:Mammalian Expression, Mouse Targeting, AAV, Cre/Lox, Synthetic Biology; Bacterial Resistance:Ampicillin
Defining Citation: PMID:37142767
Proper citation: RRID:Addgene_178334 Copy
Species: Mus musculus
Genetic Insert: pAAV CAG iGluSnFR3 v857.GPI
Vector Backbone Description: Backbone Size:4836; Vector Backbone:pAAV CAG; Vector Types:Mammalian Expression, Mouse Targeting, AAV, Cre/Lox, Synthetic Biology; Bacterial Resistance:Ampicillin
Defining Citation: PMID:37142767
Proper citation: RRID:Addgene_178335 Copy
Species: Mus musculus
Genetic Insert: pAAV GFAP iGluSnFR3 v857.PDGFR
Vector Backbone Description: Backbone Size:4852; Vector Backbone:pAAV GFAP; Vector Types:Mammalian Expression, Mouse Targeting, AAV, Cre/Lox, Synthetic Biology; Bacterial Resistance:Ampicillin
Defining Citation: PMID:37142767
Proper citation: RRID:Addgene_178336 Copy
Species: Mus musculus
Genetic Insert: Twist
Vector Backbone Description: Backbone Size:5169; Vector Backbone:pBABE-puro; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:15210113
Proper citation: RRID:Addgene_1783 Copy
Species: Mus musculus
Genetic Insert: H-2Kb
Vector Backbone Description: Backbone Marker:Chen lab; Backbone Size:7200; Vector Backbone:MDH1-404; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:17382377
Comments: The original retroviral miRNA expression construct (Chen et al., 2004) was modified
to incorporate a truncated H-2Kb surface marker and a blasticidin drug resistance gene to allow for magnetic bead assisted sorting and drug selection. These
marker genes are driven by the PGK promoter and transcribed as a bicistronic
message, with the truncated H-2Kb gene placed after the PGK promoter and the
blasticidin resistance gene after the EMCV IRES.
MiRNA gene expression is driven by the human H1 pol III promoter. The truncated H-2Kb selection marker is non-functional since it is devoid of a cytoplasmic domain and is of a different MHC haplotype than the T cells in 5C.C7 transgenic mice (H-2Kk).
Proper citation: RRID:Addgene_17852 Copy
Species: Mus musculus
Genetic Insert: GlyCAM-1/IgG
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:4356; Vector Backbone:pCDM8; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin and Tetracycline
Defining Citation: PMID:10330415
Proper citation: RRID:Addgene_17841 Copy
Species: Mus musculus
Genetic Insert: Dusp6-EGFP
Vector Backbone Description: Backbone Marker:Chen lab; Backbone Size:7600; Vector Backbone:MDH1-454; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:17382377
Comments: This construct simultaneously expresses miR-181a and the DUSP6 gene.
Proper citation: RRID:Addgene_17849 Copy
Species: Mus musculus
Genetic Insert: Txnip
Vector Backbone Description: Vector Backbone:pFUW-TetO; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:35245086
Comments: Please note: Plasmid contains a M172K mutation in mouse Txnip compared to the NCBI reference sequence NP_001009935.1. This mutation is not known to affect plasmid function.
Proper citation: RRID:Addgene_178437 Copy
Species: Mus musculus
Genetic Insert: Irf7
Vector Backbone Description: Vector Backbone:pFUW-TetO; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:35245086
Proper citation: RRID:Addgene_178445 Copy
Species: Mus musculus
Genetic Insert: siTwist
Vector Backbone Description: Backbone Size:9439; Vector Backbone:pSP-108; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:15210113
Comments: Twist-siRNA3-targetting sequence is AAGCTGAGCAAGATTCAGACC
Proper citation: RRID:Addgene_1784 Copy
Species: Mus musculus
Genetic Insert: Junb
Vector Backbone Description: Vector Backbone:pFUW-TetO; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:35245086
Proper citation: RRID:Addgene_178441 Copy
Species: Mus musculus
Genetic Insert: NFATc2
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:3900; Vector Backbone:pCR2.1-TOPO; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:8202141
Comments: Full-length mNFATc2
Proper citation: RRID:Addgene_17858 Copy
Species: Mus musculus
Genetic Insert: CnB
Vector Backbone Description: Backbone Size:3300; Vector Backbone:pBJ5; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:1377362
Proper citation: RRID:Addgene_17872 Copy
Species: Mus musculus
Genetic Insert: mCherry-Zdk1-Vav2(DH-PH-CRD)
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:4679; Vector Backbone:pmCherry-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:33890764
Proper citation: RRID:Addgene_178875 Copy
Species: Mus musculus
Genetic Insert: PB1-AzamiGreen-FRB-TEVcs(ENLYFQL)-mTagBFP2-HA-Vav2(DH-PH-CRD)
Vector Backbone Description: Backbone Marker:MBL International; Backbone Size:4244; Vector Backbone:pAsh-MCL; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:33890764
Proper citation: RRID:Addgene_178870 Copy
Species: Mus musculus
Genetic Insert: FKBP-mCherry-Vav2(DH-PH-CRD)
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:3940; Vector Backbone:pmCherry-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:33890764
Proper citation: RRID:Addgene_178865 Copy
Species: Mus musculus
Genetic Insert: DnaJ (Hsp40) homolog, subfamily B, member 3
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5137; Vector Backbone:pcDNA5/FRT/TO; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:18686016
Comments: Part of the HSP40 gene family
Disclaimer:
For cloning the various HSP genes, the Stratagene reference RNA for cDNA synthesis was used and genes were amplified from this mixture that originates from 10 different cell lines from different somatic origin and ultimately coming from 10 different individuals. This strategy was used to maximize the chance for the presence of individual HSP transcripts. Users must be aware that this mixture thus represents 20 complete haploid genomes, meaning that for each individual gene there might be polymorphisms that could potentially have functional consequences. The library was sequence verified only for the presence of the correct gene.
Proper citation: RRID:Addgene_19525 Copy
Species: Mus musculus
Genetic Insert: DNAJB10
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5137; Vector Backbone:pcDNA5/FRT/TO; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:18686016
Comments: Part of the HSP40 gene family
Disclaimer:
For cloning the various HSP genes, the Stratagene reference RNA for cDNA synthesis was used and genes were amplified from this mixture that originates from 10 different cell lines from different somatic origin and ultimately coming from 10 different individuals. This strategy was used to maximize the chance for the presence of individual HSP transcripts. Users must be aware that this mixture thus represents 20 complete haploid genomes, meaning that for each individual gene there might be polymorphisms that could potentially have functional consequences. The library was sequence verified only for the presence of the correct gene.
Proper citation: RRID:Addgene_19560 Copy
Species: Mus musculus
Genetic Insert: DNAJB10
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5137; Vector Backbone:pcDNA5/FRT/TO; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:18686016
Comments: Part of the HSP40 gene family
Disclaimer:
For cloning the various HSP genes, the Stratagene reference RNA for cDNA synthesis was used and genes were amplified from this mixture that originates from 10 different cell lines from different somatic origin and ultimately coming from 10 different individuals. This strategy was used to maximize the chance for the presence of individual HSP transcripts. Users must be aware that this mixture thus represents 20 complete haploid genomes, meaning that for each individual gene there might be polymorphisms that could potentially have functional consequences. The library was sequence verified only for the presence of the correct gene.
Proper citation: RRID:Addgene_19533 Copy
Species: Mus musculus
Genetic Insert: M33
Vector Backbone Description: Backbone Size:5100; Vector Backbone:pBABE-puro; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:12167701
Comments: (Kingston #1222)
Proper citation: RRID:Addgene_1952 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within RRID that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.