Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Vector Backbone Description: Backbone Marker:David Root; Backbone Size:7000; Vector Backbone:pLKO.1; Vector Types:Mammalian Expression, Lentiviral, RNAi; Bacterial Resistance:Ampicillin
Defining Citation: PMID:20890297
Proper citation: RRID:Addgene_26655 Copy
Species: Homo sapiens
Genetic Insert: Rheb1 shRNA
Vector Backbone Description: Backbone Marker:Available at Addgene (#8453); Backbone Size:7000; Vector Backbone:pLKO.1 puro; Vector Types:Mammalian Expression, Lentiviral, RNAi; Bacterial Resistance:Ampicillin
Defining Citation: PMID:18497260
Comments: shRNA directed against Rheb1. Target sequence: 5'-CCTCAGACATACTCCATAGAT-3'.
Proper citation: RRID:Addgene_26625 Copy
Species: Homo sapiens
Genetic Insert: RagB shRNA
Vector Backbone Description: Backbone Marker:Available at Addgene (#8453); Backbone Size:7000; Vector Backbone:pLKO.1 puro; Vector Types:Mammalian Expression, Lentiviral, RNAi; Bacterial Resistance:Ampicillin
Defining Citation: PMID:18497260
Comments: shRNA directed against RagB. Target sequence: 5'-CGGGACAACATCTTCCGAAAT-3'. Sequence from the website of the RNAi consortium at the Broad institute.
Proper citation: RRID:Addgene_26627 Copy
Species: Homo sapiens
Genetic Insert: Rheb1 shRNA
Vector Backbone Description: Backbone Marker:Available at Addgene (#8453); Backbone Size:7000; Vector Backbone:pLKO.1 puro; Vector Types:Mammalian Expression, Lentiviral, RNAi; Bacterial Resistance:Ampicillin
Defining Citation: PMID:18497260
Comments: shRNA directed against Rheb1. Target sequence: 5'-TTATGTTGGTTGGGAATAAGA-3'.
Proper citation: RRID:Addgene_26626 Copy
Species: mammalian codon optimized
Genetic Insert: iLOV
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:4700; Vector Backbone:pEGFP-N1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:19060199
Comments: iLOV codon usage was optimized for mammalian cell expression by de novo gene synthesis (GenScript) and cloned into pEGFP-N1 (Clontech) via SalI and NotI to replace the GFP encoding sequence.
Proper citation: RRID:Addgene_26588 Copy
Species: Arabidopsis thaliana
Genetic Insert: iLOV
Vector Backbone Description: Backbone Marker:GE Healthcare; Backbone Size:4900; Vector Backbone:pGEX-4T-1; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19060199
Proper citation: RRID:Addgene_26587 Copy
Genetic Insert: Enhanced Green Fluorescent Protein
Vector Backbone Description: Backbone Size:7580; Vector Backbone:p156RRL-sinPPT-CMV-GFP-PRE/Nhe I; Vector Types:Mammalian Expression, Lentiviral, Tet-On Advanced vector; Bacterial Resistance:Ampicillin
Comments: Need to be transduced in a Tet-On Advanced cell line for expression of the GFP.
There are a few mismatches between Addgene's sequence and Dr Campeau's sequence. The sequence difference does not affect plasmid function.
Proper citation: RRID:Addgene_26584 Copy
Genetic Insert: Enhanced Green Fluorescent Protein
Vector Backbone Description: Backbone Size:8045; Vector Backbone:p156RRL-sinPPT-CMV-GFP-PRE/Nhe I; Vector Types:Mammalian Expression, Lentiviral, Tet-On Advanced vector; Bacterial Resistance:Ampicillin
Comments: Need to be transduced in a Tet-On Advanced cell line for expression of GFP.
There are a few mismatches between Addgene's sequence and Dr Campeau's sequence. The sequence differences do not affect GFP expression or general plasmid function.
Proper citation: RRID:Addgene_26586 Copy
Genetic Insert: Enhanced Green Fluorescent Protein
Vector Backbone Description: Backbone Size:8568; Vector Backbone:p156RRL-sinPPT-CMV-GFP-PRE/Nhe I; Vector Types:Mammalian Expression, Lentiviral, Tet-On Advanced vector; Bacterial Resistance:Ampicillin
Comments: Need to be transduced in a Tet-On Advanced cell line for expression of GFP.
There are a few mismatches between Addgene's sequence and Dr Campeau's sequence. The sequence differences do not affect GFP expression or general plasmid function.
Proper citation: RRID:Addgene_26585 Copy
Species: Aequorea victoria
Genetic Insert: destabilized GFP
Vector Backbone Description: Backbone Size:0; Vector Backbone:pLuxI-tet8 + pRKM-102; Vector Types:Bacterial Expression; Bacterial Resistance:Chloramphenicol
Defining Citation: PMID:15096621
Comments: A novel hybrid promoter luxPRcI-OR1 (wild-type luxPR promoter with a CI OR1 operator site inserted at the +1 transcription start) drives expression of GFP(LVA). The promoter was constructed by encoding OR1 on PCR primers and inserting it after luxPR
Proper citation: RRID:Addgene_26580 Copy
Species: Multiple synthetic genes
Genetic Insert: Synthetic
Vector Backbone Description: Backbone Size:3288; Vector Backbone:pZS2; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:20646328
Proper citation: RRID:Addgene_26598 Copy
Species: Homo sapiens
Genetic Insert: p18 shRNA
Vector Backbone Description: Backbone Marker:Available at Addgene (#8453); Backbone Size:7000; Vector Backbone:pLKO.1 puro; Vector Types:Mammalian Expression, Lentiviral, RNAi; Bacterial Resistance:Ampicillin
Defining Citation: PMID:20381137
Comments: shRNA directed against p18. Target sequence: 5'-AGACAGCCAGCAACATCATTG-3'
Proper citation: RRID:Addgene_26631 Copy
Species: Homo sapiens
Genetic Insert: raptor
Vector Backbone Description: Backbone Marker:Available at Addgene (#19319); Backbone Size:7400; Vector Backbone:pLJM1; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:20381137
Proper citation: RRID:Addgene_26633 Copy
Genetic Insert: control shRNA
Vector Backbone Description: Backbone Marker:System Biosciences; Backbone Size:7200; Vector Backbone:pSIH1-H1-puro; Vector Types:Lentiviral, RNAi; Bacterial Resistance:Ampicillin
Defining Citation: PMID:20197401
Comments: Control shRNA: AATAGCGACTAAACACATCAATTCAAGAGATTGATGTGTTTAGTCGCTATTTTTTTT
Proper citation: RRID:Addgene_26597 Copy
Species: Homo sapiens
Genetic Insert: STAT3 shRNA
Vector Backbone Description: Backbone Marker:System Biosciences; Backbone Size:7200; Vector Backbone:pSIH1-H1-puro; Vector Types:Lentiviral, RNAi; Bacterial Resistance:Ampicillin
Defining Citation: PMID:20197401
Comments: STAT3 shRNA sequence: gatccGCATCTGCCTAGATCGGCTATTCAAGAGATAGCCGATCTAGGCAGATGTTTTTTg
Proper citation: RRID:Addgene_26596 Copy
Species: Homo sapiens
Genetic Insert: Rabin8
Vector Backbone Description: Backbone Size:4700; Vector Backbone:pEGFP-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:20890297
Comments: L196A mutant in GEF domain.
Proper citation: RRID:Addgene_26727 Copy
Species: Mus musculus
Genetic Insert: Cortactin
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:4700; Vector Backbone:pEGFP-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:16280362
Proper citation: RRID:Addgene_26723 Copy
Species: Homo sapiens
Genetic Insert: Zyxin
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:4700; Vector Backbone:pDsRed-N1; Vector Types:Mammalian Expression, Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:12154072
Proper citation: RRID:Addgene_26720 Copy
Species: Human Herpes Virus 6
Genetic Insert: U69
Vector Backbone Description: Backbone Size:5000; Vector Backbone:pCGN; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:20838604
Comments: U69 Accession No.: X83413.1
Proper citation: RRID:Addgene_26689 Copy
Species: Gallus gallus
Genetic Insert: venusYFP, TVA950, Rabies Glycoprotein
Vector Backbone Description: Backbone Size:3520; Vector Backbone:pCAG-venusYFP; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:20797534
Comments: Please note that the Addgene sequencing result shows a CMV promoter is present. A CAG promoter was not identified as the plasmid name implies.
Proper citation: RRID:Addgene_26721 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within RRID that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
