Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Homo sapiens
Genetic Insert: Karyopherin Alpha 7
Vector Backbone Description: Backbone Marker:Promega; Backbone Size:4050; Vector Backbone:pCMVTNT; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:20701745
Proper citation: RRID:Addgene_26683 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: Ubiquitin
Vector Backbone Description: Backbone Marker:EMD Biosciences; Backbone Size:5400; Vector Backbone:pET-30 Xa/Lic; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:19252184
Comments: Same sequence as human Ub, except: S19, D24; S28
Proper citation: RRID:Addgene_26685 Copy
Species: unknown
Genetic Insert: Utrophin
Vector Backbone Description: Backbone Size:4097; Vector Backbone:pCS2+; Vector Types:Mammalian Expression, reporter for F-actin; Bacterial Resistance:Ampicillin
Defining Citation: PMID:17685442
Comments: The calponin homology domain of utrophin (Utr-CH) was fused to monomeric RFP in order to visualize F-actin.
Proper citation: RRID:Addgene_26739 Copy
Species: unknown
Genetic Insert: Utrophin
Vector Backbone Description: Backbone Size:4097; Vector Backbone:pCS2+; Vector Types:Mammalian Expression, reporter for F-actin; Bacterial Resistance:Ampicillin
Defining Citation: PMID:17685442
Comments: The calponin homology domain of utrophin (Utr-CH) was fused to a photoactivatable form of GFP in order to visualize F-actin.
Proper citation: RRID:Addgene_26738 Copy
Species: Xenopus laevis
Genetic Insert: Rac
Vector Backbone Description: Backbone Size:4097; Vector Backbone:pCS2+; Vector Types:Mammalian Expression, reporter for Rac; Bacterial Resistance:Ampicillin
Defining Citation: PMID:15684032
Proper citation: RRID:Addgene_26735 Copy
Species: unknown
Genetic Insert: Utrophin
Vector Backbone Description: Backbone Size:4097; Vector Backbone:pCS2+; Vector Types:Mammalian Expression, reporter for F-actin; Bacterial Resistance:Ampicillin
Defining Citation: PMID:17685442
Comments: The calponin homology domain of utrophin (Utr-CH) was fused to eGFP in order to visualize F-actin.
Uploaded sequence from depositing lab includes the complete GFP-utrophin sequence.
Please note that mutation Q236R in utrophin was found during Addgene's quality control. The mutation does NOT affect plasmid function.
Proper citation: RRID:Addgene_26737 Copy
Species: Varicella Zoster Virus (HHV-3)
Genetic Insert: ORF47
Vector Backbone Description: Backbone Size:5000; Vector Backbone:pCGN; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:20838604
Comments: ORF47 accession no.: AF314218.1
Proper citation: RRID:Addgene_26698 Copy
Genetic Insert: Hypoxia Responsive Elements (3)
Vector Backbone Description: Backbone Marker:Promega; Backbone Size:0; Vector Backbone:pGL2; Vector Types:Mammalian Expression, Luciferase; Bacterial Resistance:Ampicillin
Defining Citation: PMID:18268343
Comments: Three hypoxia response elements (24-mers) from the Pgk-1 gene upstream of firefly luciferase.
HRE: TGTCACGTCCTGCACGACTCTAGT
Note that one of the elements is a 22/24 match for the above sequence. This difference is not known to affect function.
Proper citation: RRID:Addgene_26731 Copy
Species: Herpes Simplex Virus type 1
Genetic Insert: UL13
Vector Backbone Description: Backbone Size:5000; Vector Backbone:pCGN; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:20838604
Comments: UL13 Accession No.: HM584913
Proper citation: RRID:Addgene_26697 Copy
Genetic Insert: Tetracycline repressor A3 mutant
Vector Backbone Description: Backbone Size:8669; Vector Backbone:p156RRL-sinPPT-CMV-GFP-PRE/Nhe I; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Comments: This plasmid can be used to generate Tet-On advanced cell lines. It has been reported that it works
better than other tetracycline repressor (Markusic et al. 2005).
This plasmid has a mismatch in the first attB site. The consequences of this mismatch are not clear, however depositor successfully made 2 different cell lines with that construct.
Proper citation: RRID:Addgene_26730 Copy
Species: Homo sapiens
Genetic Insert: 3x MHC I KB element - luciferase
Vector Backbone Description: Backbone Marker:Promega; Backbone Size:5600; Vector Backbone:pGL2-Basic; Vector Types:Mammalian Expression, Luciferase; Bacterial Resistance:Ampicillin
Defining Citation: PMID:7707523
Comments: The plasmid 3X-KB-L has a minimal fos promoter element and three copies of the major histocompatibility complex (MHC) class I KB element TGGGGATTCCCCA. It was constructed by ligation of the fragment obtained through digestion of MHC-NF-KB CAT by HindIII, blunting with Klenow DNA polymerase, and then digestion with BamHI. The fragment was ligated to pGL2-Basic digest(SmaI+BglII).
Proper citation: RRID:Addgene_26699 Copy
Species: Mus musculus
Genetic Insert: rhotekin
Vector Backbone Description: Backbone Size:4097; Vector Backbone:pCS2+; Vector Types:Mammalian Expression, reporter for Rho; Bacterial Resistance:Ampicillin
Defining Citation: PMID:15684032
Comments: The RhoA-binding domain of rhotekin (rGBD) was fused to eGFP in order to visualize active RhoA
Proper citation: RRID:Addgene_26732 Copy
Species: Kaposi's Sarcoma Associated Herpesvirus (HHV-8)
Genetic Insert: ORF36
Vector Backbone Description: Backbone Size:5000; Vector Backbone:pCGN; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:20838604
Comments: ORF36 accession no.: AF148805
Proper citation: RRID:Addgene_26696 Copy
Species: Kaposi's Sarcoma Associated Herpesvirus (HHV-8)
Genetic Insert: ORF36
Vector Backbone Description: Backbone Size:5000; Vector Backbone:pCGN; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:20838604
Comments: ORF36 accession no.: AF148805
Proper citation: RRID:Addgene_26695 Copy
Species: Epstein Bar Virus (EBV)
Genetic Insert: BGLF4
Vector Backbone Description: Backbone Size:5000; Vector Backbone:pCGN; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:20838604
Comments: BGLF4 Accession No.: DQ279927
Proper citation: RRID:Addgene_26691 Copy
Species: C. familiaris (dog RNAi)
Genetic Insert: dog Rab8b RNAi
Vector Backbone Description: Backbone Size:7000; Vector Backbone:pLKO.1-blast; Vector Types:Mammalian Expression, Lentiviral, RNAi; Bacterial Resistance:Ampicillin
Defining Citation: PMID:20890297
Comments: Dog Rab8b RNAi. Only matches dog. RNAi sequence is: 5'-GCGGGCAGAGCCAGGAATT-3'
Proper citation: RRID:Addgene_26708 Copy
Species: C. familiaris (dog RNAi)
Genetic Insert: dog Tuba RNAi
Vector Backbone Description: Backbone Size:7000; Vector Backbone:pLKO.1-blast; Vector Types:Mammalian Expression, Lentiviral, RNAi; Bacterial Resistance:Ampicillin
Defining Citation: PMID:20890297
Comments: RNAi to dog Tuba, but also matches multiple species, including human. RNAi target sequence is: 5'-GGAAATATGCAGATGGTGA-3'.
Proper citation: RRID:Addgene_26717 Copy
Species: C. familiaris (dog RNAi)
Genetic Insert: Dog Sec15A RNAi
Vector Backbone Description: Backbone Size:7000; Vector Backbone:pLKO.1-puro; Vector Types:Mammalian Expression, Lentiviral, RNAi; Bacterial Resistance:Ampicillin
Defining Citation: PMID:20890297
Comments: RNAi only matches dog Sec15A, does not match Sec15B. Does not match other species' Sec15A. RNAi target sequence is: 5'-GCACGGGTCATGATAGTTT-3'.
Proper citation: RRID:Addgene_26716 Copy
Species: Mus musculus
Genetic Insert: Actin-binding Protein-1
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:4700; Vector Backbone:pEGFP-C2; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:19910490
Proper citation: RRID:Addgene_26719 Copy
Species: C. familiaris (dog RNAi)
Genetic Insert: dog Tuba RNAi
Vector Backbone Description: Backbone Size:7000; Vector Backbone:pLKO.1-blast; Vector Types:Mammalian Expression, Lentiviral, RNAi; Bacterial Resistance:Ampicillin
Defining Citation: PMID:20890297
Comments: RNAi to Dog Tuba (matches dog only). RNAi target sequence is: 5'-GCAGAGAAGTTAAAGGACA-3'.
Proper citation: RRID:Addgene_26718 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within RRID that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
