Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Preparing word cloud

×

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search
Reset search
Filter by records added date

See new records

Options

Current Facets and Filters

  • Authority:addgene (facet)

Facets

Recent searches

Snippet view Table view

Can't find the RRID you're searching for? X
Click the to add this resource to a Collection

178,636 Results - per page

Show More Columns | Download Top 1000 Results

Plasmid Name

Sort Ascending

Sort Descending

 Proper Citation

Sort Ascending

Sort Descending

 Insert Name

Sort Ascending

Sort Descending

 Organism

Sort Ascending

Sort Descending

 Bacterial Resistance

Sort Ascending

Sort Descending

 Defining Citation

Sort Ascending

Sort Descending

 Comments
Vector Backbone Description
Relevant Mutation
Record Last Update

Sort Ascending

Sort Descending

 Mentions Count

Sort Ascending

Sort Descending
pJUMP19-Pbad_P
 
Resource Report
Resource Website 		RRID:Addgene_127003 Part Pbad Synthetic Ampicillin PMID:33623824 Part sub-domesticated from CIDAR MoClo toolkit (PMID: 26479688) Please visit https://www.biorxiv.org/content/10.1101/799585v1 for bioRxiv preprint. Backbone Marker:Backbone derived from SEVA.; Vector Backbone:pJUMP19-Pac; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Ampicillin None 2026-09-05 12:46:52 0
pHCKan-yibDp-GFPuv
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_127078 GFPuv Kanamycin PMID:32441815 Please visit https://www.biorxiv.org/content/10.1101/820787v2 for bioRxiv preprint. Backbone Marker:Lucigen; Vector Backbone:pSMART-HC-Kan; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin 2026-09-05 12:46:53 4
pTKhc-yibDp-GFP-β20cp6
 
Resource Report
Resource Website 		RRID:Addgene_127060 GFPcp6-beta20 Kanamycin PMID:32441815 Please visit https://www.biorxiv.org/content/10.1101/820787v2 for bioRxiv preprint. Backbone Marker:Twist; Vector Backbone:pTKHC; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin 2026-09-05 12:46:53 0
CROPseq-Guide-Zeo
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_127173 Ampicillin PMID:31626775 Cloning Method: Golden Gate; 3' Cloning Site: aagcaccgactcggtgccac Please visit https://www.biorxiv.org/content/10.1101/383943v1 for bioRxiv preprint. Vector Backbone:pLenti (Addgene #86708); Vector Types:Mammalian Expression, Lentiviral, CRISPR; Bacterial Resistance:Ampicillin 2026-09-05 12:46:54 2
p65-mNeonGreen
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_127172 GFP-RelA Homo sapiens Ampicillin PMID:31626775 Cloning Site 3-prime: CCACATAGCGTAAAAGGAGC Please visit https://www.biorxiv.org/content/10.1101/383943v1 for bioRxiv preprint. Vector Backbone:pLenti (Addgene #61427); Vector Types:Mammalian Expression, Lentiviral, CRISPR; Bacterial Resistance:Ampicillin 2026-09-05 12:46:54 1
pL_FR_Hygro
 
Resource Report
Resource Website 		RRID:Addgene_127171 Frameshift Reporter Mammalian Ampicillin PMID:31626775 Cloning Site 3-prime: CCACATAGCGTAAAAGGAGC Please visit https://www.biorxiv.org/content/10.1101/383943v1 for bioRxiv preprint. Vector Backbone:pHR (Addgene #67928); Vector Types:Mammalian Expression, Lentiviral, CRISPR; Bacterial Resistance:Ampicillin 2026-09-05 12:46:54 0
LentiGuide-BC-EF1a-Puro
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_127170 None Ampicillin PMID:31626775 Cloning Method: Golden Gate; Cloning Site 3-prime: CCACATAGCGTAAAAGGAGC Please visit https://www.biorxiv.org/content/10.1101/383943v1 for bioRxiv preprint. Vector Backbone:pLenti (Addgene #61427); Vector Types:Mammalian Expression, Lentiviral, CRISPR; Bacterial Resistance:Ampicillin 2026-09-05 12:46:54 2
pAN1779
 
Resource Report
Resource Website 		RRID:Addgene_127165 pGAL1-Z3PM-psd-tADH1-pGAL1-mKate2-psd-tPGK1-pZ3-Venus-cODC-tTDH1 Synthetic Kanamycin PMID:31341280 Vector Backbone:Custom MoClo backbone; Vector Types:Synthetic Biology; Bacterial Resistance:Kanamycin 2026-09-05 12:46:54 0
pAN1232
 
Resource Report
Resource Website 		RRID:Addgene_127164 pRPL18B-GEM-degronSwitchA-tENO2-pZ3-keyA-mTurquoise2-NLS(SV40)-tTDH1 Kanamycin PMID:31341280 Vector Backbone:Custom MoClo Backbone; Vector Types:Synthetic Biology; Bacterial Resistance:Kanamycin 2026-09-05 12:46:54 0
LentiGuide-BC-start
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_127168 Ampicillin PMID:31626775 Cloning Method: Two-step Golden Gate; Cloning Site 3-prime: CCACATAGCGTAAAAGGAGC Please visit https://www.biorxiv.org/content/10.1101/383943v1 for bioRxiv preprint. Vector Backbone:pLenti (Addgene #61427); Vector Types:Mammalian Expression, Lentiviral, CRISPR; Bacterial Resistance:Ampicillin 2026-09-05 12:46:54 1
pRSFDuet-sumo-h-cGASCD(K427E/K428E)
 
Resource Report
Resource Website 		RRID:Addgene_127162 MB21D1 Homo sapiens Kanamycin PMID:31113940 Backbone Marker:Novagen; Backbone Size:4114; Vector Backbone:pRSFDuet; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin None 2026-09-05 12:46:54 0
pRSFDuet-sumo-h-cGAS
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_127161 MB21D1 Homo sapiens Kanamycin PMID:31113940 Backbone Marker:Novagen; Backbone Size:4114; Vector Backbone:pRSFDuet; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin None 2026-09-05 12:46:54 1
AbVec2.0-mIghg3
 
Resource Report
Resource Website 		RRID:Addgene_127160 Ighg3 Mus musculus Ampicillin Backbone Size:5729; Vector Backbone:pUC19; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-09-05 12:46:54 0
pCS2-PLK1-mCherry
 
Resource Report
Resource Website 		RRID:Addgene_127154 PLK1-mCherry Homo sapiens Ampicillin PMID:31042116 Backbone Size:4091; Vector Backbone:pCS2; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-09-05 12:46:53 0
pET-Sac-Abeta(MC1-40)
 
Resource Report
Resource Website 		RRID:Addgene_127152 Abeta(MC1-40) Homo sapiens Ampicillin Backbone Size:4700; Vector Backbone:pET vector; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin 2026-09-05 12:46:53 0
AbVec2.0-mIghg2c
 
Resource Report
Resource Website 		RRID:Addgene_127159 Ighg2c Mus musculus Ampicillin Backbone Size:5729; Vector Backbone:pUC19; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-09-05 12:46:54 0
AbVec2.0-mIghg1
 
Resource Report
Resource Website 		RRID:Addgene_127158 Ighg1 Mus musculus Ampicillin Backbone Size:5729; Vector Backbone:pUC19; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-09-05 12:46:54 0
AbVec2.0-mIgkc
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_127157 Igkc Mus musculus Ampicillin PMID:33268892 ENA accession: LR588433, https://www.ebi.ac.uk/ena/browser/view/LR588433 Backbone Size:5729; Vector Backbone:pUC19; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-09-05 12:46:54 1
AbVec2.1-mIglc2
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_127156 Iglc2 Mus musculus Ampicillin PMID:33268892 ENA accession: LR588434, https://www.ebi.ac.uk/ena/browser/view/LR588434 Backbone Size:5729; Vector Backbone:pUC19; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-09-05 12:46:53 1
pET-Sac-Abeta(MC1-42)
 
Resource Report
Resource Website 		RRID:Addgene_127151 Abeta(MC1-42) Homo sapiens Ampicillin PMID:33793198 Backbone Size:4700; Vector Backbone:pET vector; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin 2026-09-05 12:46:53 0

Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
X

  1. RRID Portal Resources

    Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search

  5. Collections

    If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  6. Facets

    Here are the facets that you can filter the data by.

  7. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

About

Welcome to the Resource Identification Portal Community.

Please see Force11 for more detailed information

We thank the NIH for their support of the RRID portal Award# R24GM144308, U24DK097771, U24DA039832, HHSN276201700124P, 75N97021P00135

Recent News Entries

Contact Us

Our Information

rii-help *at* scicrunch.org

About SciCrunch | Privacy Policy | Terms of Service

SciCrunch