Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
| Plasmid Name | Proper Citation | Insert Name | Organism | Bacterial Resistance | Defining Citation |
Comments |
||||
|---|---|---|---|---|---|---|---|---|---|---|
|
pJUMP19-Pbad_P Resource Report Resource Website |
RRID:Addgene_127003 | Part Pbad | Synthetic | Ampicillin | PMID:33623824 | Part sub-domesticated from CIDAR MoClo toolkit (PMID: 26479688) Please visit https://www.biorxiv.org/content/10.1101/799585v1 for bioRxiv preprint. | Backbone Marker:Backbone derived from SEVA.; Vector Backbone:pJUMP19-Pac; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Ampicillin | None | 2026-09-05 12:46:52 | 0 |
|
pHCKan-yibDp-GFPuv Resource Report Resource Website 1+ mentions |
RRID:Addgene_127078 | GFPuv | Kanamycin | PMID:32441815 | Please visit https://www.biorxiv.org/content/10.1101/820787v2 for bioRxiv preprint. | Backbone Marker:Lucigen; Vector Backbone:pSMART-HC-Kan; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin | 2026-09-05 12:46:53 | 4 | ||
|
pTKhc-yibDp-GFP-β20cp6 Resource Report Resource Website |
RRID:Addgene_127060 | GFPcp6-beta20 | Kanamycin | PMID:32441815 | Please visit https://www.biorxiv.org/content/10.1101/820787v2 for bioRxiv preprint. | Backbone Marker:Twist; Vector Backbone:pTKHC; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin | 2026-09-05 12:46:53 | 0 | ||
|
CROPseq-Guide-Zeo Resource Report Resource Website 1+ mentions |
RRID:Addgene_127173 | Ampicillin | PMID:31626775 | Cloning Method: Golden Gate; 3' Cloning Site: aagcaccgactcggtgccac Please visit https://www.biorxiv.org/content/10.1101/383943v1 for bioRxiv preprint. | Vector Backbone:pLenti (Addgene #86708); Vector Types:Mammalian Expression, Lentiviral, CRISPR; Bacterial Resistance:Ampicillin | 2026-09-05 12:46:54 | 2 | |||
|
p65-mNeonGreen Resource Report Resource Website 1+ mentions |
RRID:Addgene_127172 | GFP-RelA | Homo sapiens | Ampicillin | PMID:31626775 | Cloning Site 3-prime: CCACATAGCGTAAAAGGAGC Please visit https://www.biorxiv.org/content/10.1101/383943v1 for bioRxiv preprint. | Vector Backbone:pLenti (Addgene #61427); Vector Types:Mammalian Expression, Lentiviral, CRISPR; Bacterial Resistance:Ampicillin | 2026-09-05 12:46:54 | 1 | |
|
pL_FR_Hygro Resource Report Resource Website |
RRID:Addgene_127171 | Frameshift Reporter | Mammalian | Ampicillin | PMID:31626775 | Cloning Site 3-prime: CCACATAGCGTAAAAGGAGC Please visit https://www.biorxiv.org/content/10.1101/383943v1 for bioRxiv preprint. | Vector Backbone:pHR (Addgene #67928); Vector Types:Mammalian Expression, Lentiviral, CRISPR; Bacterial Resistance:Ampicillin | 2026-09-05 12:46:54 | 0 | |
|
LentiGuide-BC-EF1a-Puro Resource Report Resource Website 1+ mentions |
RRID:Addgene_127170 | None | Ampicillin | PMID:31626775 | Cloning Method: Golden Gate; Cloning Site 3-prime: CCACATAGCGTAAAAGGAGC Please visit https://www.biorxiv.org/content/10.1101/383943v1 for bioRxiv preprint. | Vector Backbone:pLenti (Addgene #61427); Vector Types:Mammalian Expression, Lentiviral, CRISPR; Bacterial Resistance:Ampicillin | 2026-09-05 12:46:54 | 2 | ||
|
pAN1779 Resource Report Resource Website |
RRID:Addgene_127165 | pGAL1-Z3PM-psd-tADH1-pGAL1-mKate2-psd-tPGK1-pZ3-Venus-cODC-tTDH1 | Synthetic | Kanamycin | PMID:31341280 | Vector Backbone:Custom MoClo backbone; Vector Types:Synthetic Biology; Bacterial Resistance:Kanamycin | 2026-09-05 12:46:54 | 0 | ||
|
pAN1232 Resource Report Resource Website |
RRID:Addgene_127164 | pRPL18B-GEM-degronSwitchA-tENO2-pZ3-keyA-mTurquoise2-NLS(SV40)-tTDH1 | Kanamycin | PMID:31341280 | Vector Backbone:Custom MoClo Backbone; Vector Types:Synthetic Biology; Bacterial Resistance:Kanamycin | 2026-09-05 12:46:54 | 0 | |||
|
LentiGuide-BC-start Resource Report Resource Website 1+ mentions |
RRID:Addgene_127168 | Ampicillin | PMID:31626775 | Cloning Method: Two-step Golden Gate; Cloning Site 3-prime: CCACATAGCGTAAAAGGAGC Please visit https://www.biorxiv.org/content/10.1101/383943v1 for bioRxiv preprint. | Vector Backbone:pLenti (Addgene #61427); Vector Types:Mammalian Expression, Lentiviral, CRISPR; Bacterial Resistance:Ampicillin | 2026-09-05 12:46:54 | 1 | |||
|
pRSFDuet-sumo-h-cGASCD(K427E/K428E) Resource Report Resource Website |
RRID:Addgene_127162 | MB21D1 | Homo sapiens | Kanamycin | PMID:31113940 | Backbone Marker:Novagen; Backbone Size:4114; Vector Backbone:pRSFDuet; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin | None | 2026-09-05 12:46:54 | 0 | |
|
pRSFDuet-sumo-h-cGAS Resource Report Resource Website 1+ mentions |
RRID:Addgene_127161 | MB21D1 | Homo sapiens | Kanamycin | PMID:31113940 | Backbone Marker:Novagen; Backbone Size:4114; Vector Backbone:pRSFDuet; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin | None | 2026-09-05 12:46:54 | 1 | |
|
AbVec2.0-mIghg3 Resource Report Resource Website |
RRID:Addgene_127160 | Ighg3 | Mus musculus | Ampicillin | Backbone Size:5729; Vector Backbone:pUC19; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-09-05 12:46:54 | 0 | |||
|
pCS2-PLK1-mCherry Resource Report Resource Website |
RRID:Addgene_127154 | PLK1-mCherry | Homo sapiens | Ampicillin | PMID:31042116 | Backbone Size:4091; Vector Backbone:pCS2; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-09-05 12:46:53 | 0 | ||
|
pET-Sac-Abeta(MC1-40) Resource Report Resource Website |
RRID:Addgene_127152 | Abeta(MC1-40) | Homo sapiens | Ampicillin | Backbone Size:4700; Vector Backbone:pET vector; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | 2026-09-05 12:46:53 | 0 | |||
|
AbVec2.0-mIghg2c Resource Report Resource Website |
RRID:Addgene_127159 | Ighg2c | Mus musculus | Ampicillin | Backbone Size:5729; Vector Backbone:pUC19; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-09-05 12:46:54 | 0 | |||
|
AbVec2.0-mIghg1 Resource Report Resource Website |
RRID:Addgene_127158 | Ighg1 | Mus musculus | Ampicillin | Backbone Size:5729; Vector Backbone:pUC19; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-09-05 12:46:54 | 0 | |||
|
AbVec2.0-mIgkc Resource Report Resource Website 1+ mentions |
RRID:Addgene_127157 | Igkc | Mus musculus | Ampicillin | PMID:33268892 | ENA accession: LR588433, https://www.ebi.ac.uk/ena/browser/view/LR588433 | Backbone Size:5729; Vector Backbone:pUC19; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-09-05 12:46:54 | 1 | |
|
AbVec2.1-mIglc2 Resource Report Resource Website 1+ mentions |
RRID:Addgene_127156 | Iglc2 | Mus musculus | Ampicillin | PMID:33268892 | ENA accession: LR588434, https://www.ebi.ac.uk/ena/browser/view/LR588434 | Backbone Size:5729; Vector Backbone:pUC19; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-09-05 12:46:53 | 1 | |
|
pET-Sac-Abeta(MC1-42) Resource Report Resource Website |
RRID:Addgene_127151 | Abeta(MC1-42) | Homo sapiens | Ampicillin | PMID:33793198 | Backbone Size:4700; Vector Backbone:pET vector; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | 2026-09-05 12:46:53 | 0 |
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.