Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Mus musculus
Genetic Insert: Synectin
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:4700; Vector Backbone:pEYFP-C; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:16908842
Comments: This construct contains a K111R mutation when compared to GenBank ID NP_061241.1 This mutation is most likely a sequence conflict, one of several (see Uniprot entry Q9Z0G0). The plasmid is exactly as described in the associated publication.
Proper citation: RRID:Addgene_35791 Copy
Species: Mus musculus
Genetic Insert: Syx2
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:4700; Vector Backbone:pEYFP-C; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:16467373
Comments: This construct contains a R205K mutation when compared to GenBank ID NP_001004156.1 This mutation reflects the sequence of the original mouse cDNA clone and was not introduced erroneously. The plasmid is exactly as described in the associated publication.
Proper citation: RRID:Addgene_35703 Copy
Species: Mus musculus
Genetic Insert: Syx1
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:4700; Vector Backbone:pEYFP-C; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:16467373
Comments: This construct contains a R205K mutation when compared to GenBank ID NP_001004156.1 This mutation reflects the sequence of the original mouse cDNA clone and was not introduced erroneously. The plasmid is exactly as described in the associated publication.
Proper citation: RRID:Addgene_35709 Copy
Species: Mus musculus
Genetic Insert: FoxO1-ADA-GFP
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:4700; Vector Backbone:pEGFP-N1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:20519497
Comments: E15G and G282R mutations are present in this insert but are not known to affect function. There are also K219R and L619P polymorphisms. Plasmid should still function as expected of the ADA.
Proper citation: RRID:Addgene_35640 Copy
Species: Mus musculus
Genetic Insert: Sstr3
Vector Backbone Description: Backbone Marker:Contech; Backbone Size:4700; Vector Backbone:pEGFP-N3; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:18256283
Proper citation: RRID:Addgene_35623 Copy
Species: Mus musculus
Genetic Insert: SERT
Vector Backbone Description: Vector Backbone:pCR2.1; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:16515684
Proper citation: RRID:Addgene_35628 Copy
Species: Mus musculus
Genetic Insert: NET
Vector Backbone Description: Backbone Marker:Stratagene; Backbone Size:3000; Vector Backbone:pBlueScript II SK(+); Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:16515684
Proper citation: RRID:Addgene_35627 Copy
Species: Mus musculus
Genetic Insert: Caspase 12
Vector Backbone Description: Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:10638761
Proper citation: RRID:Addgene_35574 Copy
Species: Mus musculus
Genetic Insert: nAChr alpha6mEGFP
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5015; Vector Backbone:pcDNA3.1-zeo; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21609715
Proper citation: RRID:Addgene_35611 Copy
Species: Mus musculus
Genetic Insert: Tie2 promoter-1st exon-1st intron
Vector Backbone Description: Backbone Marker:Stratagene; Backbone Size:3000; Vector Backbone:pBluescript II SK (+); Vector Types:; Bacterial Resistance:Ampicillin
Defining Citation: PMID:9096345
Comments: TIE2 genomic subclone DNA containing the 10kb enhancer fragment (NaeI-SalI or NotI)
The depositing laboratory recommends digesting plasmid DNA obtained by minipreps with NaeI+SalI or NotI to verify the presence of the 10 kb enhancer fragment.
Proper citation: RRID:Addgene_35966 Copy
Species: Mus musculus
Genetic Insert: Tie2 promoter
Vector Backbone Description: Backbone Marker:Stratagene; Backbone Size:3000; Vector Backbone:pBluescriptII SK (+); Vector Types:; Bacterial Resistance:Ampicillin
Defining Citation: PMID:9096345
Comments: Positive control DNA where LacZ is expressed under the control of Tie2 promoter and minimum enhancer fragment.
This plasmid is unstable in bacteria. The depositing laboratory recommends performing minipreps, as larger scale preps tend to result in recombination. To verify the plasmid, perform separate digests with KpnI and HindIII. KpnI should produce two bands at approximately 7kb and 3kb. HindIII should produce two bands at approximately 8kb and 2kb. See Addgene's diagnostic digest as an example.
Proper citation: RRID:Addgene_35964 Copy
Species: Mus musculus
Genetic Insert: Tie2 promoter
Vector Backbone Description: Backbone Marker:Promega; Backbone Size:2462; Vector Backbone:pSP72; Vector Types:; Bacterial Resistance:Ampicillin
Defining Citation: PMID:9096345
Comments: Same as pSPTg.T2FpAXK except that there is no sv40 polyA signal fragment
Proper citation: RRID:Addgene_35963 Copy
Species: Mus musculus
Genetic Insert: Synectin
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5250; Vector Backbone:pcDNA4/HisMax; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:16908842
Comments: This construct contains a K111R mutation when compared to GenBank ID NP_061241.1 This mutation is most likely a sequence conflict, one of several (see Uniprot entry Q9Z0G0). The plasmid is exactly as described in the associated publication.
Proper citation: RRID:Addgene_35943 Copy
Species: Mus musculus
Genetic Insert: zfp423 shRNA
Vector Backbone Description: Backbone Size:6700; Vector Backbone:pMKO.1; Vector Types:Mammalian Expression, Retroviral, RNAi; Bacterial Resistance:Ampicillin
Defining Citation: PMID:20200519
Comments: Forward Oligo 5'
CCGGCCCTGAATGTAACGTGAAGTTCTCGAGAACTTCACGTTACATTCAGGGTTTTTG 3'
Reverse Oligo 5'
AATTCAAAAACCCTGAATGTAACGTGAAGTTCTCGAGAACTTCACGTTACATTCAGGG 3'
Proper citation: RRID:Addgene_35972 Copy
Species: Mus musculus
Genetic Insert: G protein beta subunit B4
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5428; Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:17581822
Proper citation: RRID:Addgene_36114 Copy
Species: Mus musculus
Genetic Insert: G protein subunit Gamma 4
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5428; Vector Backbone:pcDNA3.1; Vector Types:; Bacterial Resistance:Ampicillin
Defining Citation: PMID:17581822
Proper citation: RRID:Addgene_36104 Copy
Species: Mus musculus
Genetic Insert: G protein subunit Gamma 3
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:7261; Vector Backbone:pDEST12.2; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:17581822
Proper citation: RRID:Addgene_36103 Copy
Species: Mus musculus
Genetic Insert: G protein subunit Gamma 10
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5428; Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:17581822
Proper citation: RRID:Addgene_36108 Copy
Species: Mus musculus
Genetic Insert: Pax2
Vector Backbone Description: Backbone Size:7164; Vector Backbone:pCMVbeta; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:11032856
Proper citation: RRID:Addgene_36052 Copy
Species: Mus musculus
Genetic Insert: Dynamin 3
Vector Backbone Description: Backbone Marker:Invitrogen; Vector Backbone:pcDNA3; Vector Types:Mammalian Expression, Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:17463283
Proper citation: RRID:Addgene_36265 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within RRID that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
