Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: E. coli
Genetic Insert: Relevant genotype: supE, thi, Δ(lac-proAB), [F' traD36, proAB, lacIqZΔM15]
Vector Backbone Description: Vector Backbone:N/A; Vector Types:; Bacterial Resistance:None
Proper citation: RRID:Addgene_50349 Copy
Species: E. coli
Genetic Insert: Relevant genotype: ara, Δ(lac-proAB), rspL(+strA), ϕ80, lacZΔM15
Vector Backbone Description: Vector Backbone:N/A; Vector Types:; Bacterial Resistance:None
Proper citation: RRID:Addgene_50348 Copy
Genetic Insert: see comments
Vector Backbone Description: Vector Backbone:N/A; Vector Types:Synthetic Biology; Bacterial Resistance:None
Defining Citation: PMID:26261213
Comments: MG1655 + lacIq intergrated at intS + ΔglmZ
Proper citation: RRID:Addgene_63667 Copy
Species: E.coli
Genetic Insert: none
Vector Backbone Description: Vector Backbone:none; Vector Types:Synthetic Biology; Bacterial Resistance:None
Defining Citation: PMID:25087841
Proper citation: RRID:Addgene_52944 Copy
Species: E.coli
Genetic Insert: none
Vector Backbone Description: Vector Backbone:none; Vector Types:Synthetic Biology; Bacterial Resistance:None
Defining Citation: PMID:25087841
Proper citation: RRID:Addgene_52940 Copy
Species: E.coli
Genetic Insert: none
Vector Backbone Description: Vector Backbone:none; Vector Types:Synthetic Biology; Bacterial Resistance:None
Proper citation: RRID:Addgene_52951 Copy
Species: E.coli
Genetic Insert: none
Vector Backbone Description: Vector Backbone:none; Vector Types:Synthetic Biology; Bacterial Resistance:None
Proper citation: RRID:Addgene_52952 Copy
Genetic Insert: Carries a single chromosomal copy of constitutively active PhoP downstream of PcpcG2 promoter inserted in nupG locus
Vector Backbone Description: Vector Backbone:n/a; Vector Types:; Bacterial Resistance:None
Defining Citation: PMID:41996246
Comments: For validation, use primers: FWD: CGTGAGCGGTAAAGTTGTTG and REV: CGGAGCTGCAAGGTGTTTATAG flanking the nupG locus to verify gene insertion.
Please visit https://doi.org/10.1101/2024.11.27.625634 for bioRxiv preprint.
Proper citation: RRID:Addgene_254897 Copy
Genetic Insert: Carries a single chromosomal copy of the repressor TetR downstream of PcpcG2 promoter inserted in nupG locus
Vector Backbone Description: Vector Backbone:n/a; Vector Types:; Bacterial Resistance:None
Defining Citation: PMID:41996246
Comments: For validation, use primers: FWD: CGTGAGCGGTAAAGTTGTTG and REV: CGGAGCTGCAAGGTGTTTATAG flanking the nupG locus to verify gene insertion.
Please visit https://doi.org/10.1101/2024.11.27.625634 for bioRxiv preprint.
Proper citation: RRID:Addgene_254898 Copy
Genetic Insert: MG1655 attP21::PR-mYFP::frt
Vector Backbone Description: Vector Backbone:NA; Vector Types:; Bacterial Resistance:None
Defining Citation: PMID:29355812
Comments: Strain Validation: Fluorescence, PCR for fluorescent marker gene.
Inserted into attP21 and PCR-verified following methods described in Haldimann and Wanner, JBact 2001, PMID 11591683, using pAH68FRT-Cat as cloning and insertion plasmid.
Proper citation: RRID:Addgene_230031 Copy
Genetic Insert: MG1655 attP21::PR-mCherry::frt
Vector Backbone Description: Vector Backbone:NA; Vector Types:; Bacterial Resistance:None
Defining Citation: PMID:28428424
Comments: Strain Validation: Fluorescence, PCR for fluorescent marker gene.
Inserted into attP21 and PCR-verified following methods described in Haldimann and Wanner, JBact 2001, PMID 11591683, using pAH68FRT-Cat as cloning and insertion plasmid. TB205 is fliC+ and wrongly annotated as ∆fliC in PMID 28428424.
Proper citation: RRID:Addgene_230034 Copy
Genetic Insert: MG1655 attP21::PR-sfGFP::frt
Vector Backbone Description: Vector Backbone:NA; Vector Types:; Bacterial Resistance:None
Defining Citation: PMID:29355812
Comments: Strain Validation: Fluorescence, PCR for fluorescent marker gene.
Inserted into attP21 and PCR-verified following methods described in Haldimann and Wanner, JBact 2001, PMID 11591683, using pAH68FRT-Cat as cloning and insertion plasmid.
Proper citation: RRID:Addgene_230033 Copy
Genetic Insert: MG1655 attP21::PR-mCerulean::frt
Vector Backbone Description: Vector Backbone:NA; Vector Types:; Bacterial Resistance:None
Comments: Strain Validation: Fluorescence, PCR for fluorescent marker gene.
Inserted into attP21 and PCR-verified following methods described in Haldimann and Wanner, JBact 2001, PMID 11591683, using pAH68FRT-Cat as cloning and insertion plasmid.
Proper citation: RRID:Addgene_230032 Copy
Genetic Insert: MG1655 attP21::PR-mCherry::frt trpC::frt
Vector Backbone Description: Vector Backbone:NA; Vector Types:; Bacterial Resistance:None
Defining Citation: PMID:32042125
Comments: Strain Validation: Fluorescence, growth in M9+glucose +/- tryptophane, PCRs with primers flanking fluorescent marker gene or deleted gene.
Primers:
trpC_fwd: AACGTCGCCATGTTAATGCG
trpC_rev: GAACTGAGCCTGAAATTCAGG
Proper citation: RRID:Addgene_230038 Copy
Genetic Insert: MG1655 attP21::PR-sfGFP::frt trpC::frt
Vector Backbone Description: Vector Backbone:NA; Vector Types:; Bacterial Resistance:None
Defining Citation: PMID:32042125
Comments: Strain Validation: Fluorescence, growth in M9+glucose +/- tryptophane, PCRs with primers flanking fluorescent marker gene or deleted gene.
Primers:
trpC_fwd: AACGTCGCCATGTTAATGCG
trpC_rev: GAACTGAGCCTGAAATTCAGG
Proper citation: RRID:Addgene_230037 Copy
Genetic Insert: ΔrpiAB Δedd strain
Vector Backbone Description: Vector Backbone:n/a; Vector Types:This is a strain, not a plasmid; Bacterial Resistance:None
Proper citation: RRID:Addgene_234837 Copy
Species: n/a
Genetic Insert: MG1655 attP21::PR-mCherry::frt proC::frt hisL::frt
Vector Backbone Description: Vector Backbone:n/a; Vector Types:This is a strain, not a plasmid; Bacterial Resistance:None
Defining Citation: PMID:40509754
Comments: Primers for sequence verification of hisL knock-out:
Fwd - prEP229, gtgaggataagaggtggcga
Rev - prEP230, tcctttccccgctcattcat
Please visit https://doi.org/10.1101/2024.07.19.604250 for bioRxiv preprint.
Proper citation: RRID:Addgene_229552 Copy
Species: n/a
Genetic Insert: MG1655 attP21::PR-sfGFP::frt metB:frt proBA::proB74proA
Vector Backbone Description: Vector Backbone:n/a; Vector Types:This is a strain, not a plasmid; Bacterial Resistance:None
Defining Citation: PMID:40509754
Comments: Primers for sequence verification of proB mutation:
Fwd - prEP169, cgcggttatgtgaagaacgt
Rev - prEP170, gtgatgtcgcgttataccgg
Please visit https://doi.org/10.1101/2024.07.19.604250 for bioRxiv preprint.
Proper citation: RRID:Addgene_229551 Copy
Species: n/a
Genetic Insert: MG1655 attP21::PR-sfGFP::frt metB:frt
Vector Backbone Description: Vector Backbone:n/a; Vector Types:This is a strain, not a plasmid; Bacterial Resistance:None
Defining Citation: PMID:40509754
Comments: Primers for sequence verification of metB knock-out:
Fwd - prEP213, acgatcggtctggcttagtt
Rev - prEP214, tgaccgtaaacccgcatagt
Please visit https://doi.org/10.1101/2024.07.19.604250 for bioRxiv preprint.
Proper citation: RRID:Addgene_229549 Copy
Species: n/a
Genetic Insert: MG1655 attP21::PR-sfGFP::frt hisD:frt
Vector Backbone Description: Vector Backbone:n/a; Vector Types:This is a strain, not a plasmid; Bacterial Resistance:None
Defining Citation: PMID:40509754
Comments: Primers for sequence verification of hisD knock-out:
Fwd - prEP209, ccggttttacgcctgcatat
Rev - prEP210, ccgaacgcccaactattctg
Please visit https://doi.org/10.1101/2024.07.19.604250 for bioRxiv preprint.
Proper citation: RRID:Addgene_229548 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within RRID that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
