Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
| Plasmid Name | Proper Citation | Insert Name | Organism | Bacterial Resistance | Defining Citation |
Comments |
||||
|---|---|---|---|---|---|---|---|---|---|---|
|
pBIG2abc_nsp12-His6-3xFlag/nsp7/nsp8 (SARS-CoV-2) Resource Report Resource Website |
RRID:Addgene_169185 | nsp12-His6-3xFlag/nsp7/nsp8 | Synthetic | Chloramphenicol and Ampicillin | PMID:34198323 | Baculovirus generation using Tn7 transposition (Bac-to-Bac). | Vector Backbone:pBIG2abc (biGBac); Vector Types:Insect Expression; Bacterial Resistance:Chloramphenicol and Ampicillin | Codon optimised for insect cells (Spodoptera frugiperda) | 2026-08-15 01:09:58 | 0 |
|
DBD (N208AH212R) Foxo1-WT pDNR-CMV Resource Report Resource Website 1+ mentions |
RRID:Addgene_17555 | Foxo1-WT-DBD | Mus musculus | Chloramphenicol and Ampicillin | PMID:17717603 | This plasmid also contains a E226G mutation--the author has determined that this mutation does not affect the plasmid detrimentally. It also has K219R and L619P polymorphisms. | Backbone Size:5600; Vector Backbone:pDNR-CMV; Vector Types:Mammalian Expression; Bacterial Resistance:Chloramphenicol and Ampicillin | DNA binding-deficientChanged N208A H212R | 2026-08-15 01:10:51 | 2 |
|
BL21 Rosetta2 GamS Resource Report Resource Website |
RRID:Addgene_176584 | pRARE2 + pBADmod1-linker2-gamS plasmid | Chloramphenicol and Ampicillin | PMID:35034449 | Please visit https://www.biorxiv.org/content/10.1101/2021.09.07.459228v1 for bioRxiv preprint. Primers for genomic verification: Foward - tattttccagtcgtgaaagc Reverse - ttgctgatttcttccatcag Primers for GamS plasmid verification: Forward - aattatgacaacttgacggctacatcattc Reverse - cgttcaccgacaaacaaca | Vector Backbone:Unknown; Vector Types:; Bacterial Resistance:Chloramphenicol and Ampicillin | 2026-08-15 01:11:00 | 0 | ||
|
BL21 Rosetta2 ΔrecBCD GamS Resource Report Resource Website |
RRID:Addgene_176586 | pRARE2 + pBADmod1-linker2-gamS plasmid | Chloramphenicol and Ampicillin | PMID:35034449 | Please visit https://www.biorxiv.org/content/10.1101/2021.09.07.459228v1 for bioRxiv preprint. Primers for recBCD deletion verification: Foward - ttgatttactgcccgagagc Reverse - gtcaaccgaatgcagacatc Primers for GamS plasmid verification: Forward - aattatgacaacttgacggctacatcattc Reverse - cgttcaccgacaaacaaca | Vector Backbone:Strain; Vector Types:; Bacterial Resistance:Chloramphenicol and Ampicillin | recBCD genomic deletion | 2026-08-15 01:11:00 | 0 | |
|
pBRC_double_attB_GFP_donor Resource Report Resource Website |
RRID:Addgene_169692 | Chloramphenicol and Ampicillin | PMID:34791215 | Please visit https://doi.org/10.1101/2020.11.25.398784 for bioRxiv preprint. | Backbone Marker:Andrew Fire; Vector Backbone:pPD158.87; Vector Types:Worm Expression; Bacterial Resistance:Chloramphenicol and Ampicillin | 2026-08-15 01:10:01 | 0 | |||
|
pDEST-DHFR F[1,2]-C (TRP1) Resource Report Resource Website |
RRID:Addgene_177795 | Chloramphenicol and Ampicillin | PMID:35137167 | Please visit https://www.biorxiv.org/content/10.1101/2021.07.27.453987v1 for bioRxiv preprint. | Backbone Size:10394; Vector Backbone:pDEST-AD-CYH2; Vector Types:Yeast Expression; Bacterial Resistance:Chloramphenicol and Ampicillin | 2026-08-15 01:11:12 | 0 | |||
|
pDEST-DHFR F[3]-N (LEU2) Resource Report Resource Website |
RRID:Addgene_177798 | Chloramphenicol and Ampicillin | PMID:35137167 | Please visit https://www.biorxiv.org/content/10.1101/2021.07.27.453987v1 for bioRxiv preprint. | Backbone Size:10164; Vector Backbone:pDEST-DB; Vector Types:Yeast Expression; Bacterial Resistance:Chloramphenicol and Ampicillin | 2026-08-15 01:11:12 | 0 | |||
|
pDEST-DHFR F[1,2]-N (TRP1) Resource Report Resource Website |
RRID:Addgene_177797 | Chloramphenicol and Ampicillin | PMID:35137167 | Please visit https://www.biorxiv.org/content/10.1101/2021.07.27.453987v1 for bioRxiv preprint. | Backbone Size:10388; Vector Backbone:pDEST-AD-CYH2; Vector Types:Yeast Expression; Bacterial Resistance:Chloramphenicol and Ampicillin | 2026-08-15 01:11:11 | 0 | |||
|
pEFS-ccdB-12X MS2_mPGK-Puro Resource Report Resource Website |
RRID:Addgene_177809 | Chloramphenicol and Ampicillin | PMID:35087108 | This plasmid was designed to tag transcripts of insert at the 3' with an 12X MS2 stem loop tag. Insertion of the transcript of interst is performed by BsaI cloning. 5' BsaI generates ACAG overhang (BsaI recognition site 2659-2664) 3' BsaI generates CCCG overhang (BsaI recognition site 4086-4091) These BsaI sites are lost upon insertion of the transcript of interest. | Backbone Size:2686; Vector Backbone:pUC19; Vector Types:Mammalian Expression; Bacterial Resistance:Chloramphenicol and Ampicillin | 2026-08-15 01:11:12 | 0 | |||
|
pANG01 Resource Report Resource Website |
RRID:Addgene_178083 | Chloramphenicol and Ampicillin | PMID:34801582 | The plasmids from this article are also used with plasmid pXint129 (www.addgene.org/178208). | Backbone Marker:NA, NA, Invitrogen; Vector Backbone:pGP704, pBAD33, pDONR201; Vector Types:Bacterial Expression; Bacterial Resistance:Chloramphenicol and Ampicillin | 2026-08-15 01:11:14 | 0 | |||
|
pGRG37 Resource Report Resource Website |
RRID:Addgene_16667 | mTn7::Gateway cassette | Chloramphenicol and Ampicillin | PMID:16646962 | Grow at 32'C. Contains Gateway cassette with ccdB gene. See author's protocol for more information. This plasmid is designed to insert DNA into the chromosome of Enterobacteria in a manner that doesn't require a drug resistance marker. This plasmid uses the site-specific recombination machinery of the bacterial transposon Tn7. The backbone of the plasmid is the easily curable temperature sensitive mutant of pSC101. | Backbone Size:14263; Vector Backbone:pGRG37; Vector Types:Bacterial Expression; Bacterial Resistance:Chloramphenicol and Ampicillin | 2026-08-15 01:09:37 | 0 | ||
|
pLenti CMV Neo DEST (705-1) Resource Report Resource Website 10+ mentions |
RRID:Addgene_17392 | Chloramphenicol and Ampicillin | PMID:19657394 | Please note that Addgene's quality control sequence shows several gaps with depositor's reference sequence. These gaps are in vector region only and should not affect function. | Backbone Size:9796; Vector Backbone:p156RRL-sinPPT-CMV-GFP-PRE/Nhe I; Vector Types:Mammalian Expression, Lentiviral, Gateway Cloning; Bacterial Resistance:Chloramphenicol and Ampicillin | 2026-08-15 01:10:35 | 46 | |||
|
pQCXP CMV/TO DEST (w360-1) Resource Report Resource Website 1+ mentions |
RRID:Addgene_17386 | Chloramphenicol and Ampicillin | PMID:19657394 | Backbone Marker:Clontech; Backbone Size:8832; Vector Backbone:pQCXIP; Vector Types:Mammalian Expression, Retroviral, Gateway Cloning; Bacterial Resistance:Chloramphenicol and Ampicillin | 2026-08-15 01:10:35 | 8 | ||||
|
pQCXIN X2 DEST (w310-1) Resource Report Resource Website 1+ mentions |
RRID:Addgene_17399 | Chloramphenicol and Ampicillin | PMID:19657394 | Backbone Marker:Clontech; Backbone Size:9150; Vector Backbone:pQCXIN; Vector Types:Retroviral, RNAi, Gateway Cloning; Bacterial Resistance:Chloramphenicol and Ampicillin | 2026-08-15 01:10:36 | 3 | ||||
|
pLenti CMV/TO GFP-Zeo DEST (719-1) Resource Report Resource Website 1+ mentions |
RRID:Addgene_17431 | Chloramphenicol and Ampicillin | PMID:19657394 | Please note that there are several sequence discrepancies between Addgene's sequence and depositor's sequence. These mismatches are in backbone regions and should not affect function. | Backbone Size:10140; Vector Backbone:p156RRL-sinPPT-CMV-GFP-PRE/Nhe I; Vector Types:Mammalian Expression, Lentiviral, Gateway Cloning; Bacterial Resistance:Chloramphenicol and Ampicillin | 2026-08-15 01:10:39 | 5 | |||
|
pLenti CMV/TO DEST (775-1) Resource Report Resource Website |
RRID:Addgene_17432 | Chloramphenicol and Ampicillin | PMID:19657394 | Backbone Size:8410; Vector Backbone:p156RRL-sinPPT-CMV-GFP-PRE/Nhe I; Vector Types:Mammalian Expression, Lentiviral, Gateway Cloning; Bacterial Resistance:Chloramphenicol and Ampicillin | 2026-08-15 01:10:39 | 0 | ||||
|
pLenti CMV Puro DEST (w118-1) Resource Report Resource Website 100+ mentions |
RRID:Addgene_17452 | Chloramphenicol and Ampicillin | PMID:19657394 | Backbone Size:9617; Vector Backbone:p156RRL-sinPPT-CMV-GFP-PRE/Nhe I; Vector Types:Mammalian Expression, Lentiviral, Gateway Cloning; Bacterial Resistance:Chloramphenicol and Ampicillin | 2026-08-15 01:10:41 | 206 | ||||
|
pLenti CMV Hygro DEST (w117-1) Resource Report Resource Website 50+ mentions |
RRID:Addgene_17454 | Chloramphenicol and Ampicillin | PMID:19657394 | Please note that there are several mismatches between depositor's sequence and Addgene's quality control sequence. These mismatches are in the backbone regions only and do not affect any of the features. | Backbone Size:10319; Vector Backbone:p156RRL-sinPPT-CMV-GFP-PRE/Nhe I; Vector Types:Mammalian Expression, Lentiviral, Gateway Cloning; Bacterial Resistance:Chloramphenicol and Ampicillin | 2026-08-15 01:10:41 | 55 | |||
|
pQCXIP X2 DEST (w270-1) Resource Report Resource Website |
RRID:Addgene_17474 | Chloramphenicol and Ampicillin | PMID:19657394 | Backbone Marker:Clontech; Backbone Size:8931; Vector Backbone:pQCXIP; Vector Types:Mammalian Expression, Retroviral, RNAi, Gateway Cloning; Bacterial Resistance:Chloramphenicol and Ampicillin | 2026-08-15 01:10:43 | 0 | ||||
|
pB-Halo,IRES-eGFP Resource Report Resource Website 1+ mentions |
RRID:Addgene_164519 | Chloramphenicol and Ampicillin | PMID:33080218 | Vector Backbone:PB-TAG-ERN; Vector Types:Mammalian Expression; Bacterial Resistance:Chloramphenicol and Ampicillin | 2026-08-15 01:09:21 | 1 |
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
