Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
| Plasmid Name | Proper Citation | Insert Name | Organism | Bacterial Resistance | Defining Citation |
Comments |
||||
|---|---|---|---|---|---|---|---|---|---|---|
|
JM101 Resource Report Resource Website |
RRID:Addgene_50349 | Relevant genotype: supE, thi, Δ(lac-proAB), [F' traD36, proAB, lacIqZΔM15] | E. coli | None | Vector Backbone:N/A; Vector Types:; Bacterial Resistance:None | 2026-08-15 01:16:05 | 0 | |||
|
JM83 Resource Report Resource Website |
RRID:Addgene_50348 | Relevant genotype: ara, Δ(lac-proAB), rspL(+strA), ϕ80, lacZΔM15 | E. coli | None | Vector Backbone:N/A; Vector Types:; Bacterial Resistance:None | 2026-08-15 01:16:07 | 0 | |||
|
HL 5226 Resource Report Resource Website |
RRID:Addgene_63667 | see comments | None | PMID:26261213 | MG1655 + lacIq intergrated at intS + ΔglmZ | Vector Backbone:N/A; Vector Types:Synthetic Biology; Bacterial Resistance:None | 2026-08-15 01:18:04 | 0 | ||
|
HL 4233 Resource Report Resource Website |
RRID:Addgene_52944 | none | E.coli | None | PMID:25087841 | Vector Backbone:none; Vector Types:Synthetic Biology; Bacterial Resistance:None | 2026-08-15 01:16:26 | 0 | ||
|
HL 932 Resource Report Resource Website |
RRID:Addgene_52940 | none | E.coli | None | PMID:25087841 | Vector Backbone:none; Vector Types:Synthetic Biology; Bacterial Resistance:None | 2026-08-15 01:16:26 | 0 | ||
|
HL3796 Resource Report Resource Website 1+ mentions |
RRID:Addgene_52951 | none | E.coli | None | Vector Backbone:none; Vector Types:Synthetic Biology; Bacterial Resistance:None | 2026-08-15 01:16:26 | 2 | |||
|
HL4018 Resource Report Resource Website |
RRID:Addgene_52952 | none | E.coli | None | Vector Backbone:none; Vector Types:Synthetic Biology; Bacterial Resistance:None | 2026-08-15 01:16:26 | 0 | |||
|
E. coli BW25113 ΔphoP:PcpcG2-phoP*** (CMB259) Resource Report Resource Website |
RRID:Addgene_254897 | Carries a single chromosomal copy of constitutively active PhoP downstream of PcpcG2 promoter inserted in nupG locus | None | PMID:41996246 | For validation, use primers: FWD: CGTGAGCGGTAAAGTTGTTG and REV: CGGAGCTGCAAGGTGTTTATAG flanking the nupG locus to verify gene insertion. Please visit https://doi.org/10.1101/2024.11.27.625634 for bioRxiv preprint. | Vector Backbone:n/a; Vector Types:; Bacterial Resistance:None | 2026-08-15 01:35:53 | 0 | ||
|
E. coli BW25113:PcpcG2-tetR (CMB247) Resource Report Resource Website |
RRID:Addgene_254898 | Carries a single chromosomal copy of the repressor TetR downstream of PcpcG2 promoter inserted in nupG locus | None | PMID:41996246 | For validation, use primers: FWD: CGTGAGCGGTAAAGTTGTTG and REV: CGGAGCTGCAAGGTGTTTATAG flanking the nupG locus to verify gene insertion. Please visit https://doi.org/10.1101/2024.11.27.625634 for bioRxiv preprint. | Vector Backbone:n/a; Vector Types:; Bacterial Resistance:None | 2026-08-15 01:35:53 | 0 | ||
|
TB201 Resource Report Resource Website |
RRID:Addgene_230031 | MG1655 attP21::PR-mYFP::frt | None | PMID:29355812 | Strain Validation: Fluorescence, PCR for fluorescent marker gene. Inserted into attP21 and PCR-verified following methods described in Haldimann and Wanner, JBact 2001, PMID 11591683, using pAH68FRT-Cat as cloning and insertion plasmid. | Vector Backbone:NA; Vector Types:; Bacterial Resistance:None | 2026-08-15 01:31:48 | 0 | ||
|
TB205 Resource Report Resource Website |
RRID:Addgene_230034 | MG1655 attP21::PR-mCherry::frt | None | PMID:28428424 | Strain Validation: Fluorescence, PCR for fluorescent marker gene. Inserted into attP21 and PCR-verified following methods described in Haldimann and Wanner, JBact 2001, PMID 11591683, using pAH68FRT-Cat as cloning and insertion plasmid. TB205 is fliC+ and wrongly annotated as ∆fliC in PMID 28428424. | Vector Backbone:NA; Vector Types:; Bacterial Resistance:None | 2026-08-15 01:31:48 | 0 | ||
|
TB204 Resource Report Resource Website |
RRID:Addgene_230033 | MG1655 attP21::PR-sfGFP::frt | None | PMID:29355812 | Strain Validation: Fluorescence, PCR for fluorescent marker gene. Inserted into attP21 and PCR-verified following methods described in Haldimann and Wanner, JBact 2001, PMID 11591683, using pAH68FRT-Cat as cloning and insertion plasmid. | Vector Backbone:NA; Vector Types:; Bacterial Resistance:None | 2026-08-15 01:31:48 | 0 | ||
|
TB202 Resource Report Resource Website |
RRID:Addgene_230032 | MG1655 attP21::PR-mCerulean::frt | None | Strain Validation: Fluorescence, PCR for fluorescent marker gene. Inserted into attP21 and PCR-verified following methods described in Haldimann and Wanner, JBact 2001, PMID 11591683, using pAH68FRT-Cat as cloning and insertion plasmid. | Vector Backbone:NA; Vector Types:; Bacterial Resistance:None | 2026-08-15 01:31:48 | 0 | |||
|
TB205 △trpC Resource Report Resource Website |
RRID:Addgene_230038 | MG1655 attP21::PR-mCherry::frt trpC::frt | None | PMID:32042125 | Strain Validation: Fluorescence, growth in M9+glucose +/- tryptophane, PCRs with primers flanking fluorescent marker gene or deleted gene. Primers: trpC_fwd: AACGTCGCCATGTTAATGCG trpC_rev: GAACTGAGCCTGAAATTCAGG | Vector Backbone:NA; Vector Types:; Bacterial Resistance:None | 2026-08-15 01:31:47 | 0 | ||
|
TB204 △trpC Resource Report Resource Website |
RRID:Addgene_230037 | MG1655 attP21::PR-sfGFP::frt trpC::frt | None | PMID:32042125 | Strain Validation: Fluorescence, growth in M9+glucose +/- tryptophane, PCRs with primers flanking fluorescent marker gene or deleted gene. Primers: trpC_fwd: AACGTCGCCATGTTAATGCG trpC_rev: GAACTGAGCCTGAAATTCAGG | Vector Backbone:NA; Vector Types:; Bacterial Resistance:None | 2026-08-15 01:31:47 | 0 | ||
|
Δrpi Resource Report Resource Website |
RRID:Addgene_234837 | ΔrpiAB Δedd strain | None | Vector Backbone:n/a; Vector Types:This is a strain, not a plasmid; Bacterial Resistance:None | 2026-08-15 01:33:27 | 0 | ||||
|
TB205 △proC △hisL Resource Report Resource Website |
RRID:Addgene_229552 | MG1655 attP21::PR-mCherry::frt proC::frt hisL::frt | n/a | None | PMID:40509754 | Primers for sequence verification of hisL knock-out: Fwd - prEP229, gtgaggataagaggtggcga Rev - prEP230, tcctttccccgctcattcat Please visit https://doi.org/10.1101/2024.07.19.604250 for bioRxiv preprint. | Vector Backbone:n/a; Vector Types:This is a strain, not a plasmid; Bacterial Resistance:None | 2026-08-15 01:33:02 | 0 | |
|
TB204 △metB proB74 Resource Report Resource Website |
RRID:Addgene_229551 | MG1655 attP21::PR-sfGFP::frt metB:frt proBA::proB74proA | n/a | None | PMID:40509754 | Primers for sequence verification of proB mutation: Fwd - prEP169, cgcggttatgtgaagaacgt Rev - prEP170, gtgatgtcgcgttataccgg Please visit https://doi.org/10.1101/2024.07.19.604250 for bioRxiv preprint. | Vector Backbone:n/a; Vector Types:This is a strain, not a plasmid; Bacterial Resistance:None | in proB: Aspartic acid 107 mutated to asparagine (D107N) GAT->AAT | 2026-08-15 01:33:02 | 0 |
|
TB204 △metB Resource Report Resource Website |
RRID:Addgene_229549 | MG1655 attP21::PR-sfGFP::frt metB:frt | n/a | None | PMID:40509754 | Primers for sequence verification of metB knock-out: Fwd - prEP213, acgatcggtctggcttagtt Rev - prEP214, tgaccgtaaacccgcatagt Please visit https://doi.org/10.1101/2024.07.19.604250 for bioRxiv preprint. | Vector Backbone:n/a; Vector Types:This is a strain, not a plasmid; Bacterial Resistance:None | 2026-08-15 01:33:02 | 0 | |
|
TB204 △hisD Resource Report Resource Website |
RRID:Addgene_229548 | MG1655 attP21::PR-sfGFP::frt hisD:frt | n/a | None | PMID:40509754 | Primers for sequence verification of hisD knock-out: Fwd - prEP209, ccggttttacgcctgcatat Rev - prEP210, ccgaacgcccaactattctg Please visit https://doi.org/10.1101/2024.07.19.604250 for bioRxiv preprint. | Vector Backbone:n/a; Vector Types:This is a strain, not a plasmid; Bacterial Resistance:None | 2026-08-15 01:33:02 | 0 |
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
