Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
| Plasmid Name | Proper Citation | Insert Name | Organism | Bacterial Resistance | Defining Citation |
Comments |
||||
|---|---|---|---|---|---|---|---|---|---|---|
|
pAGM1287 Resource Report Resource Website 1+ mentions |
RRID:Addgene_47996 | Spectinomycin | PMID:21364738 | level 0 cloning vector | Backbone Marker:self-made; Backbone Size:2247; Vector Backbone:pUC19-derived; Vector Types:Unspecified; Bacterial Resistance:Spectinomycin | 2026-08-15 01:15:46 | 6 | |||
|
pICH41276 Resource Report Resource Website 1+ mentions |
RRID:Addgene_47994 | Spectinomycin | PMID:21364738 | level 0 cloning vector | Backbone Marker:self-made; Backbone Size:2247; Vector Backbone:pUC19-derived; Vector Types:Unspecified; Bacterial Resistance:Spectinomycin | 2026-08-15 01:15:47 | 2 | |||
|
pICH41331 Resource Report Resource Website |
RRID:Addgene_47999 | Spectinomycin | PMID:21364738 | level 0 cloning vector | Backbone Marker:self-made; Backbone Size:2247; Vector Backbone:pUC19-derived; Vector Types:Unspecified; Bacterial Resistance:Spectinomycin | 2026-08-15 01:15:46 | 0 | |||
|
pICH41295 Resource Report Resource Website 1+ mentions |
RRID:Addgene_47997 | Spectinomycin | PMID:21364738 | level 0 cloning vector | Backbone Marker:self-made; Backbone Size:2247; Vector Backbone:pUC19-derived; Vector Types:Unspecified; Bacterial Resistance:Spectinomycin | 2026-08-15 01:15:47 | 2 | |||
|
pICH41308 Resource Report Resource Website 1+ mentions |
RRID:Addgene_47998 | Spectinomycin | PMID:21364738 | level 0 cloning vector | Backbone Marker:self-made; Backbone Size:2247; Vector Backbone:pUC19-derived; Vector Types:Unspecified; Bacterial Resistance:Spectinomycin | 2026-08-15 01:15:46 | 2 | |||
|
pAGM8081 Resource Report Resource Website |
RRID:Addgene_48042 | Spectinomycin | PMID:21364738 | level M cloning vector, replicates in E.coli and Agrobacterium, binary vector for Agrobacterium T-DNA delivery to plant cells | Backbone Marker:self-made; Backbone Size:4604; Vector Backbone:derived from pBIN19 and pUC19; Vector Types:Unspecified; Bacterial Resistance:Spectinomycin | 2026-08-15 01:15:47 | 0 | |||
|
pAGM8093 Resource Report Resource Website 1+ mentions |
RRID:Addgene_48043 | Spectinomycin | PMID:21364738 | level M cloning vector, replicates in E.coli and Agrobacterium, binary vector for Agrobacterium T-DNA delivery to plant cells | Backbone Marker:self-made; Backbone Size:4604; Vector Backbone:derived from pBIN19 and pUC19; Vector Types:Unspecified; Bacterial Resistance:Spectinomycin | 2026-08-15 01:15:47 | 1 | |||
|
pICH53399 Resource Report Resource Website |
RRID:Addgene_47991 | Spectinomycin | PMID:21364738 | level 0 cloning vector | Backbone Marker:self-made; Backbone Size:2247; Vector Backbone:pUC19-derived; Vector Types:Unspecified; Bacterial Resistance:Spectinomycin | 2026-08-15 01:15:47 | 0 | |||
|
pICH41246 Resource Report Resource Website 1+ mentions |
RRID:Addgene_47992 | Spectinomycin | PMID:21364738 | level 0 cloning vector | Backbone Marker:self-made; Backbone Size:2247; Vector Backbone:pUC19-derived; Vector Types:Unspecified; Bacterial Resistance:Spectinomycin | 2026-08-15 01:15:46 | 1 | |||
|
pAGM1263 Resource Report Resource Website 1+ mentions |
RRID:Addgene_47985 | Spectinomycin | PMID:21364738 | level 0 cloning vector | Backbone Marker:self-made; Backbone Size:2247; Vector Backbone:pUC19-derived; Vector Types:Unspecified; Bacterial Resistance:Spectinomycin | 2026-08-15 01:15:47 | 1 | |||
|
pAGM8043 Resource Report Resource Website |
RRID:Addgene_48038 | Spectinomycin | PMID:21364738 | level M cloning vector, replicates in E.coli and Agrobacterium, binary vector for Agrobacterium T-DNA delivery to plant cells | Backbone Marker:self-made; Backbone Size:4604; Vector Backbone:derived from pBIN19 and pUC19; Vector Types:Unspecified; Bacterial Resistance:Spectinomycin | 2026-08-15 01:15:47 | 0 | |||
|
pAGM1276 Resource Report Resource Website |
RRID:Addgene_47986 | Spectinomycin | PMID:21364738 | level 0 cloning vector | Backbone Marker:self-made; Backbone Size:2247; Vector Backbone:pUC19-derived; Vector Types:Unspecified; Bacterial Resistance:Spectinomycin | 2026-08-15 01:15:46 | 0 | |||
|
pICH50866 Resource Report Resource Website |
RRID:Addgene_48022 | Spectinomycin | PMID:21364738 | level 2 end linker | Backbone Marker:self-made; Backbone Size:3293; Vector Backbone:pUC19-derived; Vector Types:Unspecified; Bacterial Resistance:Spectinomycin | 2026-08-15 01:15:46 | 0 | |||
|
pICH41722 Resource Report Resource Website |
RRID:Addgene_48016 | Spectinomycin | PMID:21364738 | level 2 end linker | Backbone Marker:self-made; Backbone Size:3293; Vector Backbone:pUC19-derived; Vector Types:Unspecified; Bacterial Resistance:Spectinomycin | 2026-08-15 01:15:46 | 0 | |||
|
pICH41780 Resource Report Resource Website 10+ mentions |
RRID:Addgene_48019 | Spectinomycin | PMID:21364738 | level 2 end linker | Backbone Marker:self-made; Backbone Size:3293; Vector Backbone:pUC19-derived; Vector Types:Unspecified; Bacterial Resistance:Spectinomycin | 2026-08-15 01:15:46 | 12 | |||
|
pULTRA-CNF Resource Report Resource Website 10+ mentions |
RRID:Addgene_48215 | polyspecific MJ tyrosyl synthetase | M. jannaschii | Spectinomycin | PMID:17061854 | This plasmid was also used in Chatterjee et al Biochemistry. 2013 Feb 27. PMID: 23379331 | Backbone Marker:Schultz lab; Vector Backbone:pULTRA; Vector Types:Bacterial Expression; Bacterial Resistance:Spectinomycin | Y32L, L65V, F108W, Q109M, D158G, I159A | 2026-08-15 01:15:48 | 15 |
|
pAC84-pCR8-dCas9 Resource Report Resource Website 1+ mentions |
RRID:Addgene_48218 | dCas9(D10A;H840A) | Homo sapiens | Spectinomycin | PMID:23979020 | For more information including protocols and updates, please go to http://www.crispr-on.org | Backbone Marker:Invitrogen; Backbone Size:2799; Vector Backbone:pCR8/GW/TOPO; Vector Types:CRISPR, Gateway Cloning; Bacterial Resistance:Spectinomycin | D10A;H840A | 2026-08-15 01:15:48 | 2 |
|
pAC149-pCR8-dCas9VP160 Resource Report Resource Website 1+ mentions |
RRID:Addgene_48221 | dCas9(D10A;H840A) fusion with VP160 activation domain | Homo sapiens | Spectinomycin | PMID:23979020 | For more information including protocols and updates, please go to http://www.crispr-on.org | Backbone Marker:Invitrogen; Backbone Size:2799; Vector Backbone:pCR8/GW/TOPO; Vector Types:CRISPR, Gateway Cloning; Bacterial Resistance:Spectinomycin | D10A;H840A nuclease-deficient | 2026-08-15 01:15:48 | 1 |
|
pET His6 MBP TEV co-transformation cloning vector (13S-C) Resource Report Resource Website |
RRID:Addgene_48325 | Spectinomycin | This plasmid is an empty vector to be used with a LIC cloning protocol. It has a TEV cleavable His6-MBP fusion tag on the N-terminus and a Spec resistance. To clone into this vector, add LIC fusion tags to the 5' end of your PCR primers. Forward - 5'TACTTCCAATCCAATGCA3' Reverse - 5'TTATCCACTTCCAATGTTATTA3' Linearize the plasmid with SspI and gel purify. When digesting the DNA with T4 polymerase for LIC, use dCTP for insert and dGTP for vector. The 13-series vectors were designed to enable rapid cloning for a co-expression system. Vectors are based on Novagen's Duet system. Each gene is expressed on its own vector, which has been optimized so that each gene expresses at approximately equal levels. The 13-series vectors are all compatible with 2-series transfer vectors, so if cotransformation fails, there is a readily available backup in polycistronic expression. 13S CDF origin SpecR13K ColA origin KanR2-series transfer ColE1 origin AmpR13S vectors must be cotransformed with a 2-series vector for optimal expression (that is, the presence of an empty 2A-T vector enhances expression of a gene in 13S). For triple expressions, the proteins all seem to express at approximately equal levels. Genes in the CDF vector consistently express at very slightly lower levels, so if you're trying to pull down stoichiometric complexes, it's probably best to put His6-fusion protein in this vector. More information on this vector can be found through http://qb3.berkeley.edu/qb3/macrolab/ | Backbone Size:4785; Vector Backbone:pET; Vector Types:Bacterial Expression; Bacterial Resistance:Spectinomycin | 2026-08-15 01:15:49 | 0 | ||||
|
pET His6 StrepII TEV co-transformation cloning vector (13S-HR) Resource Report Resource Website |
RRID:Addgene_48326 | Spectinomycin | This plasmid is an empty vector to be used with a LIC cloning protocol. It has a TEV cleavable His6-StrepII fusion tag on the N-terminus and a Spec resistance. To clone into this vector, add LIC fusion tags to the 5' end of your PCR primers. Forward - 5'TACTTCCAATCCAATGCA3' Reverse - 5'TTATCCACTTCCAATGTTATTA3' Linearize the plasmid with SspI and gel purify. When digesting the DNA with T4 polymerase for LIC, use dCTP for insert and dGTP for vector. The 13-series vectors were designed to enable rapid cloning for a co-expression system. Vectors are based on Novagen's Duet system. Each gene is expressed on its own vector, which has been optimized so that each gene expresses at approximately equal levels. The 13-series vectors are all compatible with 2-series transfer vectors, so if cotransformation fails, there is a readily available backup in polycistronic expression. 13S CDF origin SpecR13K ColA origin KanR2-series transfer ColE1 origin AmpR13S vectors must be cotransformed with a 2-series vector for optimal expression (that is, the presence of an empty 2A-T vector enhances expression of a gene in 13S). For triple expressions, the proteins all seem to express at approximately equal levels. Genes in the CDF vector consistently express at very slightly lower levels, so if you're trying to pull down stoichiometric complexes, it's probably best to put His6-fusion protein in this vector. More information on this vector can be found through http://qb3.berkeley.edu/qb3/macrolab/ | Backbone Size:3666; Vector Backbone:pET; Vector Types:Bacterial Expression; Bacterial Resistance:Spectinomycin | 2026-08-15 01:15:49 | 0 |
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
