Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Genetic Insert: Genotype: MC4100 ∆clpPX
Vector Backbone Description: Vector Backbone:none; Vector Types:; Bacterial Resistance:Streptomycin
Defining Citation: PMID:27732583
Comments: Strain DHL708 was built by deleting the clpPX operon with lambda-Red mediated homologous recombination. The FRT-flanked Kan cassette was then flipped out using the FLP recombinase (pCP20).
The deletion region can be PCR-amplified and sequenced using the primers CCGCTCGAGTTTACGCAGCATAACGCGCTAAATTC and CGTCAGTATATGGGGATGTTTCCCC.
Originally described in Landgraf, D., Okumus, B., Chien, P., Baker, T. A. & Paulsson, J. Segregation of molecules at cell division reveals native protein localization. Nat Methods 9, 480–482 (2012).
Proper citation: RRID:Addgene_98417 Copy
Vector Backbone Description: Vector Backbone:pUC; Vector Types:Bacterial Expression; Bacterial Resistance:Streptomycin
Defining Citation: PMID:35998606
Proper citation: RRID:Addgene_188972 Copy
Genetic Insert: GUSPlus::tOCS
Vector Backbone Description: Vector Backbone:pFP100; Vector Types:Plant Expression; Bacterial Resistance:Streptomycin
Defining Citation: PMID:36216814
Comments: Please visit https://doi.org/10.1101/2021.06.16.448628 for bioRxiv preprint.
Proper citation: RRID:Addgene_170833 Copy
Genetic Insert: FRO6p::GUSPlus::tOCS
Vector Backbone Description: Vector Backbone:pYI001; Vector Types:Plant Expression; Bacterial Resistance:Streptomycin
Defining Citation: PMID:36216814
Comments: Please visit https://doi.org/10.1101/2021.06.16.448628 for bioRxiv preprint.
Proper citation: RRID:Addgene_170840 Copy
Species: E. coli
Genetic Insert: transcriptional regulator, OxyR, cognate promoter PoxyS, fluorescent protein sfGFP
Vector Backbone Description: Backbone Marker:https://seva-plasmids.com/; Backbone Size:2390; Vector Backbone:pSEVA-based; Vector Types:Bacterial Expression; Bacterial Resistance:Streptomycin
Defining Citation: PMID:34820092
Proper citation: RRID:Addgene_194154 Copy
Species: E. coli
Genetic Insert: transcriptional regulator, OxyR, cognate promoter PoxyS, fluorescent protein mCherry
Vector Backbone Description: Backbone Marker:https://seva-plasmids.com/; Backbone Size:2754; Vector Backbone:pSEVA-based; Vector Types:Bacterial Expression; Bacterial Resistance:Streptomycin
Defining Citation: PMID:34820092
Proper citation: RRID:Addgene_194155 Copy
Genetic Insert: n/a
Vector Backbone Description: Vector Backbone:n/a; Vector Types:; Bacterial Resistance:Streptomycin
Comments: This strain has 572 genetic changes compared to the DH10B reference genome in Genbank (CP000948.1). Please see https://www.ncbi.nlm.nih.gov/nuccore/CP110017 and the accompanying paper for more details.
Proper citation: RRID:Addgene_201049 Copy
Species: Synthetic
Genetic Insert: T0 terminator - Sm resistance cassette
Vector Backbone Description: Backbone Size:4948; Vector Backbone:pSH624-ssr; Vector Types:Bacterial Expression; Bacterial Resistance:Streptomycin
Defining Citation: PMID:37798358
Proper citation: RRID:Addgene_198026 Copy
Species: Vibrio cholera
Genetic Insert: VchTniQ, VchCas5/8, VchCas7, VchCas6, VchTnsABC, CRISPR(BsaI)
Vector Backbone Description: Vector Backbone:pCDFDuet-1; Vector Types:Bacterial Expression; Bacterial Resistance:Streptomycin
Defining Citation: PMID:34478496
Proper citation: RRID:Addgene_190273 Copy
Species: Pseudomonas aeruginosa PA14
Genetic Insert: PaCas1, PaCas2-3
Vector Backbone Description: Backbone Size:2819; Vector Backbone:2S; Vector Types:Bacterial Expression; Bacterial Resistance:Streptomycin
Defining Citation: PMID:37710013
Proper citation: RRID:Addgene_200216 Copy
Species: Pseudomonas aeruginosa PA14
Genetic Insert: PaCas1, PaCas2-3
Vector Backbone Description: Backbone Size:2819; Vector Backbone:2S; Vector Types:Bacterial Expression; Bacterial Resistance:Streptomycin
Defining Citation: PMID:37710013
Proper citation: RRID:Addgene_200217 Copy
Genetic Insert: plasmid for adenine base editing; oriV(pRO1600/ColE1), xylS, Pm→repA, P14b→msfGFP; Pm→ ABE:SpRY, PEM7→non-specific sgRNA
Vector Backbone Description: Backbone Marker:SEVA collection; Vector Backbone:pSEVA448; Vector Types:CRISPR, Pseudomonas vector; Bacterial Resistance:Streptomycin
Defining Citation: PMID:38180826
Proper citation: RRID:Addgene_207528 Copy
Species: Pseudomonas aeruginosa PA14
Genetic Insert: PaCas1, PaCas2-3
Vector Backbone Description: Backbone Size:2819; Vector Backbone:2S; Vector Types:Bacterial Expression; Bacterial Resistance:Streptomycin
Defining Citation: PMID:37710013
Proper citation: RRID:Addgene_200218 Copy
Genetic Insert: xylS (cured of BsaI-sites), Pm→ Sp dCas9, PEM7 →sgRNA; SmR/SpR
Vector Backbone Description: Vector Backbone:pSEVA448; Vector Types:Pseudomonas vector; Bacterial Resistance:Streptomycin
Defining Citation: PMID:38180826
Proper citation: RRID:Addgene_207524 Copy
Genetic Insert: oriV(pRO1600/ColE1), xylS, Pm→repA, P14b with a translational BCD2 coupler from BG35 (53)→msfGFP;
Vector Backbone Description: Backbone Marker:SEVA collection; Vector Backbone:pSEVA448; Vector Types:CRISPR, Pseudomonas vector; Bacterial Resistance:Streptomycin
Defining Citation: PMID:38180826
Proper citation: RRID:Addgene_207525 Copy
Genetic Insert: Plasmid for adenine base editing; oriV(pRO1600/ColE1), xylS (cured of BsaI-sites), Pm→ ABE:SpnCas9, PEM7→non-specific sgRNA
Vector Backbone Description: Backbone Marker:SEVA collection; Vector Backbone:pSEVA448; Vector Types:CRISPR, Pseudomonas vector; Bacterial Resistance:Streptomycin
Defining Citation: PMID:38180826
Proper citation: RRID:Addgene_207531 Copy
Genetic Insert: RhaR
Vector Backbone Description: Backbone Marker:Dongru Qiu, Hongwei D. Yu; Backbone Size:5216; Vector Backbone:pHERD30T; Vector Types:Mammalian Expression; Bacterial Resistance:Streptomycin
Defining Citation: PMID:37975669
Comments: Please visit https://doi.org/10.1101/2023.06.29.547033 for bioRxiv preprint.
Proper citation: RRID:Addgene_208001 Copy
Vector Backbone Description: Backbone Size:5261; Vector Backbone:CloDF13; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Streptomycin
Defining Citation: PMID:39126322
Proper citation: RRID:Addgene_213132 Copy
Species: E. coli (Bacteria)
Genetic Insert: potH
Vector Backbone Description: Vector Backbone:PCDF Bravo ; Vector Types:Bacterial Expression; Bacterial Resistance:Streptomycin
Defining Citation: PMID:40154612
Comments: IPTG inducible
Proper citation: RRID:Addgene_216749 Copy
Species: E. coli (Bacteria)
Genetic Insert: potH
Vector Backbone Description: Vector Backbone:PCDF Bravo ; Vector Types:Bacterial Expression; Bacterial Resistance:Streptomycin
Defining Citation: PMID:40154612
Comments: IPTG inducible
Proper citation: RRID:Addgene_216750 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within RRID that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.