Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Preparing word cloud

×

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search
Reset search
Filter by records added date

See new records

Options

Current Facets and Filters

  • Organism:mus musculus (facet)

Recent searches

Snippet view Table view

Can't find the RRID you're searching for? X
Click the to add this resource to a Collection

12,957 Results - per page

Show More Columns | Download Top 1000 Results

Plasmid Name

Sort Ascending

Sort Descending

 Proper Citation

Sort Ascending

Sort Descending

 Insert Name

Sort Ascending

Sort Descending

 Organism

Sort Ascending

Sort Descending

 Bacterial Resistance

Sort Ascending

Sort Descending

 Defining Citation

Sort Ascending

Sort Descending

 Comments
Vector Backbone Description
Relevant Mutation
Record Last Update

Sort Ascending

Sort Descending

 Mentions Count

Sort Ascending

Sort Descending
pEYFP-Synectin
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_35791 Synectin Mus musculus Kanamycin PMID:16908842 This construct contains a K111R mutation when compared to GenBank ID NP_061241.1 This mutation is most likely a sequence conflict, one of several (see Uniprot entry Q9Z0G0). The plasmid is exactly as described in the associated publication. Backbone Marker:Clontech; Backbone Size:4700; Vector Backbone:pEYFP-C; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin K111R 2026-08-15 01:14:03 1
pEYFP-Syx2
 
Resource Report
Resource Website 		RRID:Addgene_35703 Syx2 Mus musculus Kanamycin PMID:16467373 This construct contains a R205K mutation when compared to GenBank ID NP_001004156.1 This mutation reflects the sequence of the original mouse cDNA clone and was not introduced erroneously. The plasmid is exactly as described in the associated publication. Backbone Marker:Clontech; Backbone Size:4700; Vector Backbone:pEYFP-C; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin R205K 2026-08-15 01:14:07 0
pEYFP-Syx1
 
Resource Report
Resource Website 		RRID:Addgene_35709 Syx1 Mus musculus Kanamycin PMID:16467373 This construct contains a R205K mutation when compared to GenBank ID NP_001004156.1 This mutation reflects the sequence of the original mouse cDNA clone and was not introduced erroneously. The plasmid is exactly as described in the associated publication. Backbone Marker:Clontech; Backbone Size:4700; Vector Backbone:pEYFP-C; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin R205K 2026-08-15 01:14:07 0
FoxO1-ADA-GFP
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_35640 FoxO1-ADA-GFP Mus musculus Kanamycin PMID:20519497 E15G and G282R mutations are present in this insert but are not known to affect function. There are also K219R and L619P polymorphisms. Plasmid should still function as expected of the ADA. Backbone Marker:Clontech; Backbone Size:4700; Vector Backbone:pEGFP-N1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin T24A, S253D and S316A mutations 2026-08-15 01:14:02 4
pEGFPN3-Sstr3
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_35623 Sstr3 Mus musculus Kanamycin PMID:18256283 Backbone Marker:Contech; Backbone Size:4700; Vector Backbone:pEGFP-N3; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin 2026-08-15 01:14:02 5
pmSTpCR21
 
Resource Report
Resource Website 		RRID:Addgene_35628 SERT Mus musculus Ampicillin PMID:16515684 Vector Backbone:pCR2.1; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:14:02 0
pmNET
 
Resource Report
Resource Website 		RRID:Addgene_35627 NET Mus musculus Ampicillin PMID:16515684 Backbone Marker:Stratagene; Backbone Size:3000; Vector Backbone:pBlueScript II SK(+); Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:14:07 0
pcDNA-Caspase 12
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_35574 Caspase 12 Mus musculus Ampicillin PMID:10638761 Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:14:02 2
pcDNA-zeo: alpha6mGFP
 
Resource Report
Resource Website 		RRID:Addgene_35611 nAChr alpha6mEGFP Mus musculus Ampicillin PMID:21609715 Backbone Marker:Invitrogen; Backbone Size:5015; Vector Backbone:pcDNA3.1-zeo; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:14:06 0
pg50-2.11 (#65)
 
Resource Report
Resource Website 		RRID:Addgene_35966 Tie2 promoter-1st exon-1st intron Mus musculus Ampicillin PMID:9096345 TIE2 genomic subclone DNA containing the 10kb enhancer fragment (NaeI-SalI or NotI) The depositing laboratory recommends digesting plasmid DNA obtained by minipreps with NaeI+SalI or NotI to verify the presence of the 10 kb enhancer fragment. Backbone Marker:Stratagene; Backbone Size:3000; Vector Backbone:pBluescript II SK (+); Vector Types:; Bacterial Resistance:Ampicillin 2026-08-15 01:14:04 0
pHHSDKXK (#19)
 
Resource Report
Resource Website 		RRID:Addgene_35964 Tie2 promoter Mus musculus Ampicillin PMID:9096345 Positive control DNA where LacZ is expressed under the control of Tie2 promoter and minimum enhancer fragment. This plasmid is unstable in bacteria. The depositing laboratory recommends performing minipreps, as larger scale preps tend to result in recombination. To verify the plasmid, perform separate digests with KpnI and HindIII. KpnI should produce two bands at approximately 7kb and 3kb. HindIII should produce two bands at approximately 8kb and 2kb. See Addgene's diagnostic digest as an example. Backbone Marker:Stratagene; Backbone Size:3000; Vector Backbone:pBluescriptII SK (+); Vector Types:; Bacterial Resistance:Ampicillin 2026-08-15 01:14:08 0
pSPTg.T2FXK (#54)
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_35963 Tie2 promoter Mus musculus Ampicillin PMID:9096345 Same as pSPTg.T2FpAXK except that there is no sv40 polyA signal fragment Backbone Marker:Promega; Backbone Size:2462; Vector Backbone:pSP72; Vector Types:; Bacterial Resistance:Ampicillin 2026-08-15 01:14:04 1
pcDNA4/HisMax-Synectin
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_35943 Synectin Mus musculus Ampicillin PMID:16908842 This construct contains a K111R mutation when compared to GenBank ID NP_061241.1 This mutation is most likely a sequence conflict, one of several (see Uniprot entry Q9Z0G0). The plasmid is exactly as described in the associated publication. Backbone Marker:Invitrogen; Backbone Size:5250; Vector Backbone:pcDNA4/HisMax; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin K111R 2026-08-15 01:14:07 1
pMKO.1-Zfp423
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_35972 zfp423 shRNA Mus musculus Ampicillin PMID:20200519 Forward Oligo 5' CCGGCCCTGAATGTAACGTGAAGTTCTCGAGAACTTCACGTTACATTCAGGGTTTTTG 3' Reverse Oligo 5' AATTCAAAAACCCTGAATGTAACGTGAAGTTCTCGAGAACTTCACGTTACATTCAGGG 3' Backbone Size:6700; Vector Backbone:pMKO.1; Vector Types:Mammalian Expression, Retroviral, RNAi; Bacterial Resistance:Ampicillin 2026-08-15 01:14:04 2
mcherry Beta 4
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_36114 G protein beta subunit B4 Mus musculus Ampicillin PMID:17581822 Backbone Marker:Invitrogen; Backbone Size:5428; Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:14:05 1
YFP Gamma 4
 
Resource Report
Resource Website 		RRID:Addgene_36104 G protein subunit Gamma 4 Mus musculus Ampicillin PMID:17581822 Backbone Marker:Invitrogen; Backbone Size:5428; Vector Backbone:pcDNA3.1; Vector Types:; Bacterial Resistance:Ampicillin 2026-08-15 01:14:05 0
YFP Gamma 3
 
Resource Report
Resource Website 		RRID:Addgene_36103 G protein subunit Gamma 3 Mus musculus Ampicillin PMID:17581822 Backbone Marker:Invitrogen; Backbone Size:7261; Vector Backbone:pDEST12.2; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:14:05 0
YFP Gamma 10
 
Resource Report
Resource Website 		RRID:Addgene_36108 G protein subunit Gamma 10 Mus musculus Ampicillin PMID:17581822 Backbone Marker:Invitrogen; Backbone Size:5428; Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:14:08 0
pCMV-Pax2
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_36052 Pax2 Mus musculus Ampicillin PMID:11032856 Backbone Size:7164; Vector Backbone:pCMVbeta; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:14:05 4
HA-mDyn3 pcDNA3
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_36265 Dynamin 3 Mus musculus Ampicillin PMID:17463283 Backbone Marker:Invitrogen; Vector Backbone:pcDNA3; Vector Types:Mammalian Expression, Bacterial Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:14:06 1

Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
X

  1. RRID Portal Resources

    Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search

  5. Collections

    If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  6. Facets

    Here are the facets that you can filter the data by.

  7. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

About

Welcome to the Resource Identification Portal Community.

Please see Force11 for more detailed information

We thank the NIH for their support of the RRID portal Award# R24GM144308, U24DK097771, U24DA039832, HHSN276201700124P, 75N97021P00135

Recent News Entries

Contact Us

Our Information

rii-help *at* scicrunch.org

About SciCrunch | Privacy Policy | Terms of Service

SciCrunch