Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search

On page 51 showing 1001 ~ 1020 out of 12,959 results
Snippet view Table view Download Top 1000 Results
Click the to add this resource to a Collection
  • RRID:Addgene_39981

    This resource has 1+ mentions.

http://www.addgene.org/39981

Species: Mus musculus
Genetic Insert: Neurotrophin 3
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5400; Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin

Proper citation: RRID:Addgene_39981 Copy   


  • RRID:Addgene_40058

http://www.addgene.org/40058

Species: Mus musculus
Genetic Insert: Slp2-a C2AB
Vector Backbone Description: Backbone Marker:Promega; Backbone Size:4900; Vector Backbone:pGEX4T-1; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22820376

Proper citation: RRID:Addgene_40058 Copy   


http://www.addgene.org/40055

Species: Mus musculus
Genetic Insert: Slp2-a E11A/R32A
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:4700; Vector Backbone:pEGFP-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:22820376

Proper citation: RRID:Addgene_40055 Copy   


  • RRID:Addgene_40053

http://www.addgene.org/40053

Species: Mus musculus
Genetic Insert: Slp2-a C2B
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:4700; Vector Backbone:pEGFP-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:22820376

Proper citation: RRID:Addgene_40053 Copy   


  • RRID:Addgene_40052

http://www.addgene.org/40052

Species: Mus musculus
Genetic Insert: Slp2-a C2A
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:4700; Vector Backbone:pEGFP-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:22820376

Proper citation: RRID:Addgene_40052 Copy   


  • RRID:Addgene_40207

    This resource has 1+ mentions.

http://www.addgene.org/40207

Species: Mus musculus
Genetic Insert: Megf10
Vector Backbone Description: Vector Backbone:pUb-GFP; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22407321

Proper citation: RRID:Addgene_40207 Copy   


  • RRID:Addgene_40355

    This resource has 1+ mentions.

http://www.addgene.org/40355

Species: Mus musculus
Genetic Insert: CD40L
Vector Backbone Description: Backbone Marker:Addgene plasmid 40569; Vector Backbone:MIEG-hCD4; Vector Types:Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19405121
Comments: The CD40-ligand (CD40L)-expressing retroviral vector was constructed by PCR amplification of cDNA from anti-CD3 activated mouse T cells with the following primers for CD40-ligand: sense 5'-CTTTCAGTCAGCATGATAGAAACA-3' and antisense 5'-TCAGAGTTTGAGTAAGCCAAAAGA-3'; these primers were used to amplify the complete coding region of mouse CD40 ligand. The CD40-ligand gene was then reamplified with primers containing XhoI and NotI sites and then cloned via XhoI and NotI sites into a retroviral vector expressing human CD4.

Proper citation: RRID:Addgene_40355 Copy   


http://www.addgene.org/40325

Species: Mus musculus
Genetic Insert: MCP-1 promoter (mutated)
Vector Backbone Description: Backbone Marker:Promega; Backbone Size:4818; Vector Backbone:pGL3-basic; Vector Types:Mammalian Expression, Luciferase; Bacterial Resistance:Ampicillin
Defining Citation: PMID:10973278
Comments: Note: Addgene NGS results identified an extra ~500 bp region upstream of the expected promoter, which contains a CMV enhancer feature. It is unknown what impact the region may have on plasmid function, but the extra sequence appears to have been present in the original sample received by Addgene. A plasmid containing the mouse MCP-1 promoter driving luciferase (pMCP-Luc) was constructed from pGL3-basic (Promega, Madison, WI) and a PCR-generated MCP-1 promoter fragment. A proofreading competent Taq reagent (AccuTaq, Sigma) was used to ensure high fidelity PCR. 1.2 kb of the MCP-1 promoter (GenBank Accession no. U12470) was obtained by PCR of C57BL/6 mouse DNA with the following primers: 5′–TCATGTATATGGCTTTCCAGGTCT–3′ (sense strand, distal to transcription start) 5′–TGCACTTCTGGCTGCTCTGAG GCA–3′ (antisense strand, proximal to transcription start) The PCR product terminates 28-bp downstream of the MCP-1 TATA site. XmaI and XhoI sites were added to the MCP-1 promoter by a second round of PCR with the primers: 5′–ATATCACCCGGGTCATGTATATGGCTTTCCAGGTCT–3′ 5′–TAGATTCTCGAGTGCACTTCTGGCTGCTCTGAGGCA–3′ and XmaI and XhoI were used to clone the MCP-1 promoter fragment into pGL3-basic. For the construction of the MCP-1 mutant promoter, the BCL-6 site was mutated by a two step PCR–based strategy using the above flanking primers and the following complementary primers to mutate the BCL-6 site: 5′–TCTCTCTTCCACTTCCT[TT]AAACA–3′ 5′–TGTTT[AA]AGGAAGTGGAAGAGAGA–3′ (mutated bases are in brackets) The mutant promoter was cloned into pGL3 via XhoI and XmaI. The wild-type and mutant MCP-1 promoter sequences were verified by sequencing.

Proper citation: RRID:Addgene_40325 Copy   


  • RRID:Addgene_40281

    This resource has 10+ mentions.

http://www.addgene.org/40281

Species: Mus musculus
Genetic Insert: 2C Promoter (2-cell stage promoter)
Vector Backbone Description: Backbone Marker:Invitrogen/Life Tech; Backbone Size:6400; Vector Backbone:pcDNA Hygro; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22722858
Comments: The CMV promoter from the parent pcDNA plasmid was removed with MluI and HindIII, leaving approx. 6400kb backbone. The 2C promoter was put in its place (730bp) using the same sites. Hence, the full plasmid is 7129bp. The promoter is active shortly after fertilization of mouse embryos to about the 8-cell stage. It is also on in a subset of MESCs & miPSCs.

Proper citation: RRID:Addgene_40281 Copy   


http://www.addgene.org/40623

Species: Mus musculus
Genetic Insert: Syndecan-1 shRNA(UTR)
Vector Backbone Description: Backbone Size:10130; Vector Backbone:FUGW-H1; Vector Types:Lentiviral, RNAi; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22936997
Comments: This shRNA plasmid was generated by inserting the hairpin oligonucleotides into the FUGW-H1 lentiviral construct.

Proper citation: RRID:Addgene_40623 Copy   


  • RRID:Addgene_40605

    This resource has 1+ mentions.

http://www.addgene.org/40605

Species: Mus musculus
Genetic Insert: AMPK-γ1
Vector Backbone Description: Backbone Size:4300; Vector Backbone:pCMV-Tag4A; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:17012231
Comments: AMPK-γ1 insert has Kozak sequence embedded at 5'-terminus and a stop codon at the 3'-terminus. The FLAG of the pCMV-Tag4a backbone is out of frame.

Proper citation: RRID:Addgene_40605 Copy   


  • RRID:Addgene_40603

    This resource has 1+ mentions.

http://www.addgene.org/40603

Species: Mus musculus
Genetic Insert: AMPK-β2
Vector Backbone Description: Backbone Marker:Stratagene; Backbone Size:4300; Vector Backbone:pCMV-Tag4A; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:17012231

Proper citation: RRID:Addgene_40603 Copy   


  • RRID:Addgene_40602

http://www.addgene.org/40602

Species: Mus musculus
Genetic Insert: AMPK-β1
Vector Backbone Description: Backbone Size:4300; Vector Backbone:pCMV-Tag4A; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:17012231

Proper citation: RRID:Addgene_40602 Copy   


  • RRID:Addgene_40606

http://www.addgene.org/40606

Species: Mus musculus
Genetic Insert: AMPK-β2
Vector Backbone Description: Backbone Size:4300; Vector Backbone:pCMV-Tag5a; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:17012231
Comments: Does not express well. Minimal kozak only GCCATGGG.

Proper citation: RRID:Addgene_40606 Copy   


http://www.addgene.org/40555

Species: Mus musculus
Genetic Insert: Lrrk2
Vector Backbone Description: Backbone Marker:Emerald; Vector Backbone:pEMB44; Vector Types:Baculovirus; Bacterial Resistance:Ampicillin

Proper citation: RRID:Addgene_40555 Copy   


  • RRID:Addgene_40865

    This resource has 1+ mentions.

http://www.addgene.org/40865

Species: Mus musculus
Genetic Insert: Mouse vasopressin gene
Vector Backbone Description: Backbone Size:4000; Vector Backbone:pSE280; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:12944509
Comments: the following mutations are known and do not effect plasmid function: TT--5510CTTG, G5386A, A4984T,A6794G.

Proper citation: RRID:Addgene_40865 Copy   


  • RRID:Addgene_40799

http://www.addgene.org/40799

Species: Mus musculus
Genetic Insert: Dppa2
Vector Backbone Description: Backbone Size:8339; Vector Backbone:FUW-TetO; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22980981

Proper citation: RRID:Addgene_40799 Copy   


  • RRID:Addgene_40798

    This resource has 1+ mentions.

http://www.addgene.org/40798

Species: Mus musculus
Genetic Insert: Esrrb
Vector Backbone Description: Backbone Size:8339; Vector Backbone:FUW-TetO; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22980981

Proper citation: RRID:Addgene_40798 Copy   


  • RRID:Addgene_40801

    This resource has 1+ mentions.

http://www.addgene.org/40801

Species: Mus musculus
Genetic Insert: Ctcf
Vector Backbone Description: Backbone Size:8339; Vector Backbone:FUW-TetO; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22980981

Proper citation: RRID:Addgene_40801 Copy   


  • RRID:Addgene_40875

http://www.addgene.org/40875

Species: Mus musculus
Genetic Insert: Arl13b
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:7780; Vector Backbone:pcDNA-DEST47; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21976698
Comments: In Larkins et al (2011), this is plasmid "Arf domain GFP tagged" or "Arl domain-GFP" as referenced in Figure 2. Amino acids 1-199 of Arl13b were Gateway cloned into pcDNA-DEST47. This effectively deleted the novel C-terminal domain.

Proper citation: RRID:Addgene_40875 Copy   



Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
  1. RRID Portal Resources

    Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Save Your Search

    You can save any searches you perform for quick access to later from here.

  6. Query Expansion

    We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.

  7. Collections

    If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  8. Sources

    Here are the sources that were queried against in your search that you can investigate further.

  9. Categories

    Here are the categories present within RRID that you can filter your data on

  10. Subcategories

    Here are the subcategories present within this category that you can filter your data on

  11. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

X