Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Homo sapiens
Genetic Insert: Abr
Vector Backbone Description: Backbone Marker:Don Kohn [email protected]; Backbone Size:6600; Vector Backbone:pCCL-cppt178-MNDU3; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:17116687
Comments: Constructed by Jess Cunnick. Abr was first subcloned into pEYFP-C1 Bgl II x KpnI as a 0.4 kb 5' BamHI/BstEII + 2.2 kb BstEII- KpnI fragment. The EYFP-Abr fusion was isolated as a 5' AgeI- 3' KpnI fragment and inserted into pCCL-cppt178-MNDU3-X3 digested with Xma I x Kpn I.
Proper citation: RRID:Addgene_38155 Copy
Species: Caenorhabditis elegans
Genetic Insert: cbr-unc-119::FRT*::galk::FRT*
Vector Backbone Description: Backbone Marker:Stratagene; Backbone Size:3000; Vector Backbone:pBluescript KSII(+); Vector Types:Worm Expression, recombineering; Bacterial Resistance:Ampicillin
Comments: This plasmid carries a complementary cassette consisting of a genomic copy of the C. briggsae unc-119 gene and the selectable galK marker flanked by FRT* sites in the presumptive 3’ UTR of the Cbr-unc-119 gene.
The 3.6 kb Cbr-unc-119::FRT*::galk::FRT* cassette can be targeted by recombineering to insert between nts 281:282 in the pCC1FOS fosmid vector backbone. In other words, this cassette can be readily inserted in all fosmids contained in the C. elegans library developed by Don Moerman and colleagues. We have tested the construct in fosmid recombineering and have shown that it rescues unc-119(ed3) mutants.
Proper citation: RRID:Addgene_38149 Copy
Species: Synthetic
Genetic Insert: GoldyTALEN
Vector Backbone Description: Backbone Size:2900; Vector Backbone:pBSK; Vector Types:mRNA transcription vector; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23027955
Comments: Please note that this plasmid can be prone to recombination in bacteria. We recommend storing and propagating the construct in Stbl3 cells and screen 4-6 colonies by sequencing with TAL_F1 (ttggcgtcggcaaacagtgg) primer.
The F1 origin feature in the full plasmid sequence is in reverse compliment orientation. Please view Addgene's quality control sequence for the most accurate information. The flipped orientation does not affect the SacI site necessary to linearize the plasmid.
For further reference, this plasmid was also used in the Bedell et al Nature 2012 publication (PMID 23000899).
For more information on Carlson TALEN Add-On Plasmids please refer to: http://www.addgene.org/TALeffector/goldengate/add-ons/#carlson
Proper citation: RRID:Addgene_38142 Copy
Species: Synthetic
Genetic Insert: GoldyTALEN
Vector Backbone Description: Backbone Size:4000; Vector Backbone:pBSK; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23027955
Comments: For further reference, this plasmid was also used in the Bedell et al Nature 2012 publication (PMID 23000899).
For more information on Carlson TALEN Add-On Plasmids please refer to: http://www.addgene.org/TALeffector/goldengate/add-ons/#carlson
Proper citation: RRID:Addgene_38143 Copy
Species: Mus musculus
Genetic Insert: Jhdm2a
Vector Backbone Description: Backbone Size:5100; Vector Backbone:pcDNA4/myc-His A; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22722204
Proper citation: RRID:Addgene_38136 Copy
Species: Homo sapiens
Genetic Insert: MITF-A
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:4733; Vector Backbone:pEGFP-N1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:22692423
Proper citation: RRID:Addgene_38132 Copy
Species: Rattus norvegicus
Genetic Insert: 4EBP1
Vector Backbone Description: Backbone Marker:Broad Insitute; Backbone Size:5000; Vector Backbone:pCW57.1; Vector Types:Mammalian Expression, Lentiviral, Doxycycline inducible; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22552098
Proper citation: RRID:Addgene_38240 Copy
Species: Homo sapiens
Genetic Insert: cIAP1 H588A
Vector Backbone Description: Backbone Marker:Baltimore Lab; Backbone Size:5350; Vector Backbone:pEBB; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19243308
Proper citation: RRID:Addgene_38233 Copy
Species: Rattus norvegicus
Genetic Insert: microtubule-associated protein 1 light chain 3 beta
Vector Backbone Description: Backbone Marker:Dr. Toshio Kitamura of the University of Tokyo ; Backbone Size:5847; Vector Backbone:pMXs-IP; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:18443221
Proper citation: RRID:Addgene_38195 Copy
Species: Mus musculus
Genetic Insert: a novel protein kinase structurally related to C. elegans UNC-51
Vector Backbone Description: Backbone Marker:Dr. Toshio Kitamura of the University of Tokyo ; Backbone Size:5847; Vector Backbone:pMXs-IP; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:18443221
Proper citation: RRID:Addgene_38197 Copy
Species: Homo sapiens
Genetic Insert: BCR
Vector Backbone Description: Backbone Size:4805; Vector Backbone:pKH3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Comments: Constructed by Young Jin Cho.
A human BCR cDNA was inserted into pKH3 (Addgene plasmid #12555; obtained from Martin Schwartz) digested with BamHI x EcoRI in a three-way ligation (1.7 kb BamHI-SstI + 2.6 kb SstI-EcoRI). The 1.7 kb BamHI-SstI fragment was isolated from Bcr in pAcG2T (AddGene plasmid #38163). The 5’ sequence is
GGA TCC CCC GGG CTG CAG GAA TTC GAT GGC CGC GCC ATG-start BCR.
Proper citation: RRID:Addgene_38189 Copy
Species: Homo sapiens
Genetic Insert: BCR/ABL P190
Vector Backbone Description: Backbone Size:3000; Vector Backbone:pSK; Vector Types:construct for making transgenic mice; Bacterial Resistance:Ampicillin
Defining Citation: PMID:2179728
Comments: The DNA construct was made by Guido Jenster and Nora Heisterkamp in several cloning and subcloning steps. The transgenic construct contains human BCR exon 1, intron sequences of human BCR and ABL genes, human ABL exon 2 and ABL cDNA sequences. The transgene expression is controlled by a 200-bp Sst I- Bgl II fragment of the murine metallothionein-1 (Mt1) promoter lacking glucocorticoid-responsive elements (PMID 8541551). This BCR/ABL fusion gene produces a P190 protein and is a model for Philadelphia chromosome-positive acute lymphoblastic leukemia (ALL) in humans, which is caused by a chromosomal translocation that fuses the ABL proto-oncogene with breakpoint cluster region (BCR) sequences. Leukemia development is relatively rapid on inbred C57Bl/6J and CBA backgrounds and is slower on mixed genetic backgrounds. Mice transgenic for this construct on an inbred C57Bl/6J background are also available from Jackson labs stock 017833. The insert can be separated from the vector by digestion with Sst II.
Proper citation: RRID:Addgene_38185 Copy
Species: Homo sapiens
Genetic Insert: autophagy-related genes 13
Vector Backbone Description: Backbone Marker:Dr. Toshio Kitamura of the University of Tokyo ; Backbone Size:5847; Vector Backbone:pMXs-IP; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19211835
Proper citation: RRID:Addgene_38191 Copy
Species: Mus musculus
Genetic Insert: PTK2 protein tyrosine kinase 2
Vector Backbone Description: Backbone Marker:Dr. Toshio Kitamura of the University of Tokyo ; Backbone Size:6878; Vector Backbone:pMXs-puro; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:18443221
Proper citation: RRID:Addgene_38194 Copy
Genetic Insert: Bxb1-Excisionase
Vector Backbone Description: Backbone Size:2800; Vector Backbone:J64100; Vector Types:Synthetic Biology, BioBrick cloning vector; Bacterial Resistance:Chloramphenicol
Defining Citation: PMID:22615351
Comments: In the reset circuit, PBAD controls expression of a polycistron encoding excisionase with a strong RBS followed by Bxb1 integrase with a GTG start codon to decrease its translation rate
and increase the excisionase to integrase ratio. This construct was cloned in a plasmid
with a regulated ColE1 origin of replication (J64100, 50-70 copies, chloramphenicol resistance).
Proper citation: RRID:Addgene_38207 Copy
Species: Homo sapiens
Genetic Insert: FER
Vector Backbone Description: Backbone Marker:Pharmingen; Backbone Size:8530; Vector Backbone:pAcG2T; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin
Comments: Constructed by Leena Haataja. 4-way ligation of BamHI/NsiI + NsiI/KpnI + KpnI/EcoRI fragments into pAcG2T digested with BamHI x EcoRI. The construct makes Fer protein but not from amplified virus stocks. Large-scale yield of protein is relatively low.
Proper citation: RRID:Addgene_38167 Copy
Species: Mus musculus
Genetic Insert: Unc-51 like kinase 2
Vector Backbone Description: Backbone Marker:Dr. Toshio Kitamura of the University of Tokyo ; Backbone Size:5847; Vector Backbone:pMXs-IP; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:18443221
Proper citation: RRID:Addgene_38201 Copy
Species: Homo sapiens
Genetic Insert: ARRDC3
Vector Backbone Description: Backbone Marker:Invitrogen; Vector Backbone:pEF6; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:20559325
Proper citation: RRID:Addgene_38317 Copy
Species: Homo sapiens
Genetic Insert: TSG101
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5780; Vector Backbone:pEF6; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22315426
Comments: Please note that there is a mutation in the TSG101 ORF, Y82H. This mutation should not affect plasmid function.
Proper citation: RRID:Addgene_38318 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: 5' 1770 bp from STU2 ORF
Vector Backbone Description: Backbone Marker:GE healthcare; Backbone Size:4984; Vector Backbone:pGEX-6P-1; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22993214
Proper citation: RRID:Addgene_38314 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within RRID that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
