Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search
Reset search
On page 52 showing 1021 ~ 1040 out of 30,421 results
Snippet view Table view Download Top 1000 Results

Can't find the RRID you're searching for? X
Click the to add this resource to a Collection

    • RRID:Addgene_48138

    This resource has 1000+ mentions.

http://www.addgene.org/48138

Species: Synthetic
Genetic Insert: hSpCas9
Vector Backbone Description: Vector Backbone:PX458; Vector Types:Mammalian Expression, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24157548
Comments: For more information on Zhang Lab CRISPR Plasmids please refer to: http://www.addgene.org/crispr/zhang/.

Proper citation: RRID:Addgene_48138 Copy   

http://www.addgene.org/48238

Species: Synthetic
Genetic Insert: dCas9
Vector Backbone Description: Vector Backbone:pX335 (Addgene #42335); Vector Types:Mammalian Expression, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23979020
Comments: Clone sgRNA spacer into BbsI site. Sequence using LKO5' primer: GACTATCATATGCTTACCGT For more information including protocols and updates, please go to http://www.crispr-on.org

Proper citation: RRID:Addgene_48238 Copy   

    • RRID:Addgene_48350

http://www.addgene.org/48350

Species: Synthetic
Genetic Insert: EYFP
Vector Backbone Description: Backbone Marker:Life Technologies/Invitrogen; Backbone Size:2655; Vector Backbone:pDONRP4-P1R; Vector Types:Gateway Cloning; Bacterial Resistance:Kanamycin
Defining Citation: PMID:23957834

Proper citation: RRID:Addgene_48350 Copy   

    • RRID:Addgene_48348

http://www.addgene.org/48348

Species: Synthetic
Genetic Insert: EGFP
Vector Backbone Description: Backbone Marker:Life Technologies/Invitrogen; Backbone Size:2655; Vector Backbone:pDONRP4-P1R; Vector Types:Gateway Cloning; Bacterial Resistance:Kanamycin
Defining Citation: PMID:23957834

Proper citation: RRID:Addgene_48348 Copy   

    • RRID:Addgene_48345

    This resource has 1+ mentions.

http://www.addgene.org/48345

Species: Synthetic
Genetic Insert: mKate2
Vector Backbone Description: Backbone Marker:Life Technologies/Invitrogen; Backbone Size:2639; Vector Backbone:pDONRP2R-P3; Vector Types:Gateway Cloning; Bacterial Resistance:Kanamycin
Defining Citation: PMID:23957834

Proper citation: RRID:Addgene_48345 Copy   

http://www.addgene.org/48346

Species: Synthetic
Genetic Insert: V5 and 6xHis epitope tags cassette
Vector Backbone Description: Backbone Marker:Life Technologies/Invitrogen; Backbone Size:2645; Vector Backbone:pDONRP4-P1R; Vector Types:Gateway Cloning; Bacterial Resistance:Kanamycin
Defining Citation: PMID:23957834

Proper citation: RRID:Addgene_48346 Copy   

    • RRID:Addgene_48344

http://www.addgene.org/48344

Species: Synthetic
Genetic Insert: mKate2
Vector Backbone Description: Backbone Marker:Life Technologies/Invitrogen; Backbone Size:2646; Vector Backbone:pDONRP4-P1R; Vector Types:Gateway Cloning; Bacterial Resistance:Kanamycin
Defining Citation: PMID:23957834

Proper citation: RRID:Addgene_48344 Copy   

    • RRID:Addgene_48252

    This resource has 1+ mentions.

http://www.addgene.org/48252

Species: Synthetic
Genetic Insert: HYPER-RED-C199S
Vector Backbone Description: Backbone Size:3975; Vector Backbone:pC1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:25330925

Proper citation: RRID:Addgene_48252 Copy   

http://www.addgene.org/48240

Species: Synthetic
Genetic Insert: dCas9
Vector Backbone Description: Vector Backbone:pX335 (Addgene #42335); Vector Types:Mammalian Expression, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23979020
Comments: Clone sgRNA spacer into BbsI site. Sequence using LKO5' primer: GACTATCATATGCTTACCGT For more information including protocols and updates, please go to http://www.crispr-on.org

Proper citation: RRID:Addgene_48240 Copy   

    • RRID:Addgene_48353

http://www.addgene.org/48353

Species: Synthetic
Genetic Insert: ECFP
Vector Backbone Description: Backbone Marker:Life Technologies/Invitrogen; Backbone Size:2651; Vector Backbone:pDONRP2R-P3; Vector Types:Gateway Cloning; Bacterial Resistance:Kanamycin
Defining Citation: PMID:23957834

Proper citation: RRID:Addgene_48353 Copy   

    • RRID:Addgene_48446

http://www.addgene.org/48446

Species: Synthetic
Genetic Insert: RVD sequence: HD NI NG NN
Vector Backbone Description: Vector Backbone:pFUS_B4; Vector Types:Mammalian Expression, TALEN; Bacterial Resistance:Spectinomycin
Defining Citation: PMID:23734242
Comments: Plasmid was created using Golden Gate cloning.

Proper citation: RRID:Addgene_48446 Copy   

    • RRID:Addgene_48444

http://www.addgene.org/48444

Species: Synthetic
Genetic Insert: RVD sequence: HD NI NG NI
Vector Backbone Description: Vector Backbone:pFUS_B4; Vector Types:Mammalian Expression, TALEN; Bacterial Resistance:Spectinomycin
Defining Citation: PMID:23734242
Comments: Plasmid was created using Golden Gate cloning.

Proper citation: RRID:Addgene_48444 Copy   

    • RRID:Addgene_48449

http://www.addgene.org/48449

Species: Synthetic
Genetic Insert: RVD sequence: HD HD NI HD
Vector Backbone Description: Vector Backbone:pFUS_B4; Vector Types:Mammalian Expression, TALEN; Bacterial Resistance:Spectinomycin
Defining Citation: PMID:23734242
Comments: Plasmid was created using Golden Gate cloning.

Proper citation: RRID:Addgene_48449 Copy   

    • RRID:Addgene_48448

http://www.addgene.org/48448

Species: Synthetic
Genetic Insert: RVD sequence: HD HD NI NI
Vector Backbone Description: Vector Backbone:pFUS_B4; Vector Types:Mammalian Expression, TALEN; Bacterial Resistance:Spectinomycin
Defining Citation: PMID:23734242
Comments: Plasmid was created using Golden Gate cloning.

Proper citation: RRID:Addgene_48448 Copy   

    • RRID:Addgene_48443

http://www.addgene.org/48443

Species: Synthetic
Genetic Insert: RVD sequence: HD NI NN NG
Vector Backbone Description: Vector Backbone:pFUS_B4; Vector Types:Mammalian Expression, TALEN; Bacterial Resistance:Spectinomycin
Defining Citation: PMID:23734242
Comments: Plasmid was created using Golden Gate cloning.

Proper citation: RRID:Addgene_48443 Copy   

    • RRID:Addgene_48442

http://www.addgene.org/48442

Species: Synthetic
Genetic Insert: RVD sequence: HD NI NN NN
Vector Backbone Description: Vector Backbone:pFUS_B4; Vector Types:Mammalian Expression, TALEN; Bacterial Resistance:Spectinomycin
Defining Citation: PMID:23734242
Comments: Plasmid was created using Golden Gate cloning.

Proper citation: RRID:Addgene_48442 Copy   

    • RRID:Addgene_48440

http://www.addgene.org/48440

Species: Synthetic
Genetic Insert: RVD sequence: HD NI NN NI
Vector Backbone Description: Vector Backbone:pFUS_B4; Vector Types:Mammalian Expression, TALEN; Bacterial Resistance:Spectinomycin
Defining Citation: PMID:23734242
Comments: Plasmid was created using Golden Gate cloning.

Proper citation: RRID:Addgene_48440 Copy   

    • RRID:Addgene_48436

http://www.addgene.org/48436

Species: Synthetic
Genetic Insert: RVD sequence: HD NI HD NI
Vector Backbone Description: Vector Backbone:pFUS_B4; Vector Types:Mammalian Expression, TALEN; Bacterial Resistance:Spectinomycin
Defining Citation: PMID:23734242
Comments: Plasmid was created using Golden Gate cloning.

Proper citation: RRID:Addgene_48436 Copy   

    • RRID:Addgene_48435

http://www.addgene.org/48435

Species: Synthetic
Genetic Insert: RVD sequence: HD NI NI NG
Vector Backbone Description: Vector Backbone:pFUS_B4; Vector Types:Mammalian Expression, TALEN; Bacterial Resistance:Spectinomycin
Defining Citation: PMID:23734242
Comments: Plasmid was created using Golden Gate cloning.

Proper citation: RRID:Addgene_48435 Copy   

    • RRID:Addgene_48434

http://www.addgene.org/48434

Species: Synthetic
Genetic Insert: RVD sequence: HD NI NI NN
Vector Backbone Description: Vector Backbone:pFUS_B4; Vector Types:Mammalian Expression, TALEN; Bacterial Resistance:Spectinomycin
Defining Citation: PMID:23734242
Comments: Plasmid was created using Golden Gate cloning.

Proper citation: RRID:Addgene_48434 Copy   

Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X

  1. RRID Portal Resources

    Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search

  5. Save Your Search

    You can save any searches you perform for quick access to later from here.

  6. Query Expansion

    We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.

  7. Collections

    If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  8. Sources

    Here are the sources that were queried against in your search that you can investigate further.

  9. Categories

    Here are the categories present within RRID that you can filter your data on

  10. Subcategories

    Here are the subcategories present within this category that you can filter your data on

  11. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

X

About

Welcome to the Resource Identification Portal Community.

Please see Force11 for more detailed information

We thank the NIH for their support of the RRID portal Award# R24GM144308, U24DK097771, U24DA039832, HHSN276201700124P, 75N97021P00135

Recent News Entries

Contact Us

Our Information

rii-help *at* scicrunch.org

About SciCrunch | Privacy Policy | Terms of Service

SciCrunch