Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Saccharomyces cerevisiae
Genetic Insert: GAL4::VP16
Vector Backbone Description: Backbone Size:8770; Vector Backbone:pBPGUw; Vector Types:Insect Expression; Bacterial Resistance:Chloramphenicol and Ampicillin
Defining Citation: PMID:20697123
Proper citation: RRID:Addgene_26228 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: GAL4
Vector Backbone Description: Backbone Size:9223; Vector Backbone:pBPGUw; Vector Types:Insect Expression; Bacterial Resistance:Chloramphenicol and Ampicillin
Defining Citation: PMID:20697123
Proper citation: RRID:Addgene_26227 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: nlsLexA::GADfl
Vector Backbone Description: Backbone Size:8747; Vector Backbone:pBPGUw; Vector Types:Insect Expression; Bacterial Resistance:Chloramphenicol and Ampicillin
Defining Citation: PMID:20697123
Proper citation: RRID:Addgene_26232 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: Ubiquitin
Vector Backbone Description: Backbone Marker:EMD Biosciences; Backbone Size:5400; Vector Backbone:pET-30 Xa/Lic; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:19252184
Comments: Same sequence as human Ub, except: S19, D24; S28
Proper citation: RRID:Addgene_26685 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: Gal80
Vector Backbone Description: Backbone Size:11270; Vector Backbone:pGalW; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin
Comments: P-element based GAL80 enhancer trap
Proper citation: RRID:Addgene_26851 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: HBT-tagged ubiquitin
Vector Backbone Description: Backbone Size:5891; Vector Backbone:YEplac195-CUP1; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:16432255
Proper citation: RRID:Addgene_26900 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: ubiquitin
Vector Backbone Description: Backbone Marker:Clonetech; Backbone Size:7200; Vector Backbone:pQCXIP; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:18781797
Proper citation: RRID:Addgene_26865 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: CFP-FKBP-Inp54p (D281A)
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:4733; Vector Backbone:ECFP-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:16990515
Proper citation: RRID:Addgene_20156 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: SUMO-conjugating enzyme Ubc9
Vector Backbone Description: Backbone Marker:Stratagene; Backbone Size:6600; Vector Backbone:pESC-URA; Vector Types:Yeast Expression, yeast/bacteria shuttle; Bacterial Resistance:Ampicillin
Defining Citation: PMID:18756251
Proper citation: RRID:Addgene_20368 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: VPS4
Vector Backbone Description: Backbone Size:5037; Vector Backbone:parallel GST2; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19234443
Proper citation: RRID:Addgene_21495 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: SNF7
Vector Backbone Description: Backbone Size:5549; Vector Backbone:pHis2; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19234443
Proper citation: RRID:Addgene_21492 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: VPS20
Vector Backbone Description: Backbone Size:5549; Vector Backbone:pHis2; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19234443
Proper citation: RRID:Addgene_21490 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: polyA polymerase
Vector Backbone Description: Backbone Marker:EMD Biosciences; Backbone Size:5400; Vector Backbone:Pet21b; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:15909992
Comments: See attached purification scheme
Proper citation: RRID:Addgene_21716 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: Ura3
Vector Backbone Description: Backbone Marker:R. Kostriken; Backbone Size:2700; Vector Backbone:pRK113; Vector Types:integration sequence; Bacterial Resistance:Ampicillin
Defining Citation: PMID:3065627
Comments: Constructed by inserting a HindIII URA3 fragment into the HindIII
site of the multiple cloning site of plasmid pRK113.
Contains the 117-bp HO cut site of
MATa inserted between the HincII and BamHI sites of pUC9 and the URA3 1.17-kb HindIII fragment at the HindlIl
site transcribed away from the HO cut site.
Proper citation: RRID:Addgene_21677 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: RP51A+intron-LacZ
Vector Backbone Description: Vector Backbone:pLGSD5; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:6308621
Comments: GAL-UAS-CYC1-TATA-C7C1-ATG-RP51A+intron-LacZ
Proper citation: RRID:Addgene_33131 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: RP51A-synthetic minimal intron
Vector Backbone Description: Vector Backbone:pLGSD5; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:2655924
Comments: Original intron sequence: GTATGTTAATATGGTTAACGTCGACCGTGTTTTTGATATCTATACTAACAGGCCTTTTAATAG
Proper citation: RRID:Addgene_33149 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: RP51A-synthetic minimal intron
Vector Backbone Description: Vector Backbone:pLGSD5; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:2655924
Comments: Original intron sequence: GTATGTTAATATGGTTAACGTCGACCGTGTTTTTGATATCTATACTAACAGGCCTTTTAATAG
Proper citation: RRID:Addgene_33148 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: Rad51
Vector Backbone Description: Backbone Size:5857; Vector Backbone:pYES2; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:20864034
Proper citation: RRID:Addgene_33232 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: Rad51
Vector Backbone Description: Backbone Size:5857; Vector Backbone:pYES2; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:20864034
Proper citation: RRID:Addgene_33230 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: RP51A-synthetic minimal intron
Vector Backbone Description: Vector Backbone:pLGSD5; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:2655924
Comments: Original intron sequence: GTATGTTAATATGGTTAACGTCGACCGTGTTTTTGATATCTATACTAACAGGCCTTTTAATAG
Proper citation: RRID:Addgene_33150 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within RRID that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
