Plasmids   Select Another Resource Report Type

http://www.addgene.org/37082

Species: Synthetic
Genetic Insert: hChr2(H134R)-mCherry
Vector Backbone Description: Backbone Marker:K. Deisseroth Lab; Backbone Size:5613; Vector Backbone:pAAV-Ef1a-DIO-hChR2(H134R)-mCherry-WPRE-pA; Vector Types:AAV, Cre/Lox, Cre-Off; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22660328

Proper citation: RRID:Addgene_37082 Copy   

•   Source: Addgene

http://www.addgene.org/37083

Species: Synthetic
Genetic Insert: mCherry
Vector Backbone Description: Backbone Marker:K. Deisseroth Lab; Backbone Size:5603; Vector Backbone:pAAV-Ef1a-DIO-hChR2(H134R)-mCherry-WPRE-pA; Vector Types:AAV, Cre/Lox, Cre-On; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22866029

Proper citation: RRID:Addgene_37083 Copy   

•   Source: Addgene

http://www.addgene.org/37228

Species: Saccharomyces cerevisiae
Genetic Insert: eIF4E
Vector Backbone Description: Backbone Marker:EMD bioscience; Backbone Size:5700; Vector Backbone:pET15b; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:20864040

Proper citation: RRID:Addgene_37228 Copy   

•   Source: Addgene

http://www.addgene.org/37229

Species: Saccharomyces cerevisiae
Genetic Insert: eIF4E
Vector Backbone Description: Backbone Marker:EMD bioscience; Backbone Size:5700; Vector Backbone:pET15b; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:20864040

Proper citation: RRID:Addgene_37229 Copy   

•   Source: Addgene

http://www.addgene.org/37222

Species: Saccharomyces cerevisiae
Genetic Insert: HHtRNA
Vector Backbone Description: Backbone Size:2686; Vector Backbone:pUC19; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:17913637
Comments: HHtRNA sequence (rev orientation): TGGTAGCGCCGCTCGGTTTCGATCCGAGGACATCAGGGTTATGAGCCCTGCGCGCTTCCACTGCGCCACGGCGCTGACGGTACCGGGTACCGTTTCGTCCTCACGGACTCATCAGAGCG

Proper citation: RRID:Addgene_37222 Copy   

•   Source: Addgene

http://www.addgene.org/37183

Vector Backbone Description: Backbone Size:6025; Vector Backbone:pET; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Comments: This plasmid is an empty vector. Your gene can be inserted with a LIC cloning protocol. All 2-series vectors work as single-expression vectors, as well as transfer vectors for our polycistronic system. 2K-T has a TEV-cleavable N-terminal His6 and MBP fusion tag to enhance solubility and ease purification. These tags are preceded by a periplasmic locator signal, which is autocleaved during secretion. The PPL tag may be helpful if your protein binds to or interferes with intracellular E. coli molecules, since your protein of interest is safely sequestered in the periplasm. It may also be helpful if your protein of interest is more stable in the periplasmic environment. Protein purification may also be made simpler using this expression method. The LIC cloning site is flanked by 5 pairs of restriction sites, so that your gene can easily be subcloned into our polycistronic destination vectors (2D, 2E, or 2Z). To clone into this vector, add LIC v1 tags to the 5' end of your PCR primers. Forward - 5'TACTTCCAATCCAATGCA3' Reverse - 5'TTATCCACTTCCAATGTTATTA3' Linearize the plasmid with SspI and gel purify. When digesting the DNA with T4 polymerase, use dCTP for insert and dGTP for vector. More information on this vector can be found through http://qb3.berkeley.edu/qb3/macrolab/

Proper citation: RRID:Addgene_37183 Copy   

•   Source: Addgene

http://www.addgene.org/37184

Vector Backbone Description: Backbone Marker:CLONTECH; Backbone Size:4810; Vector Backbone:pDIRECT; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24747757
Comments: For more information on Pelczar TALEN Add-On Plasmids please refer to: http://www.addgene.org/TALeffector/goldengate/add-ons/#pelczar

Proper citation: RRID:Addgene_37184 Copy   

•   Source: Addgene

http://www.addgene.org/37192

Species: Homo sapiens
Genetic Insert: EDD C2768A
Vector Backbone Description: Backbone Marker:Stratagene; Backbone Size:4225; Vector Backbone:pSG5; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:12011095
Comments: The depositing lab has noted that mutation K503R shouldn’t be a problem as it is outside the main functional domains. There does appear to be a relatively common SNP at K503 in Latino populations so this might be a genuine SNP- http://exac.broadinstitute.org/variant/8-103338864-C-T https://www.ncbi.nlm.nih.gov/projects/SNP/snp_ref.cgi?rs=rs571861064

Proper citation: RRID:Addgene_37192 Copy   

•   Source: Addgene

http://www.addgene.org/37217

Species: Saccharomyces cerevisiae
Genetic Insert: eIF1
Vector Backbone Description: Backbone Marker:NEB; Backbone Size:7474; Vector Backbone:pTYB2; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:17913637

Proper citation: RRID:Addgene_37217 Copy   

•   Source: Addgene

http://www.addgene.org/37219

Species: Saccharomyces cerevisiae
Genetic Insert: eIF5
Vector Backbone Description: Backbone Marker:NEB; Backbone Size:7474; Vector Backbone:pTYB2; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:17913637

Proper citation: RRID:Addgene_37219 Copy   

•   Source: Addgene

http://www.addgene.org/37215

Species: Mus musculus
Genetic Insert: mouse ZO-1 shRNA
Vector Backbone Description: Backbone Size:7700; Vector Backbone:pLL5.0; Vector Types:Mammalian Expression, RNAi; Bacterial Resistance:Ampicillin
Comments: pLL5.0 derived from pLL3.7; CMV promoter replaced with 5' LTR promoter from pMSCV.

Proper citation: RRID:Addgene_37215 Copy   

•   Source: Addgene

http://www.addgene.org/37216

Species: Mus musculus
Genetic Insert: mouse ZO-1 shRNA
Vector Backbone Description: Backbone Size:7700; Vector Backbone:pLL5.0; Vector Types:Mammalian Expression, RNAi; Bacterial Resistance:Ampicillin
Comments: pLL5.0 derived from pLL3.7; CMV promoter replaced with 5' LTR promoter from pMSCV.

Proper citation: RRID:Addgene_37216 Copy   

•   Source: Addgene

http://www.addgene.org/37176

Genetic Insert: None
Vector Backbone Description: Vector Backbone:pUX3236; Vector Types:; Bacterial Resistance:Ampicillin
Comments: This strain contains Roberts lab plasmid pUX3236 which is pUX2424 (contains ~1200bp fragment from Burkholderia xenovorans LB400 with introduced terminal HindIII and SalI sites [such that HindIII – (<-rcoM1– intergenic region – coxM1′->) – SalI]) but with a higher-affinity “e↑” binding site (5′-TCCTACAGTTCACGCACGT-3′). Suitable template for amplification and mutagenesis. For strain usage see attached pdf. Please note that this strain has not been confirmed by Addgene functionally.

Proper citation: RRID:Addgene_37176 Copy   

•   Source: Addgene

http://www.addgene.org/37210

Species: canine
Genetic Insert: dog ZO-2 shRNA
Vector Backbone Description: Backbone Size:3176; Vector Backbone:pSUPER; Vector Types:Mammalian Expression, RNAi; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19605556

Proper citation: RRID:Addgene_37210 Copy   

•   Source: Addgene

http://www.addgene.org/37211

Species: canine
Genetic Insert: dog ZO-2 shRNA
Vector Backbone Description: Backbone Size:3176; Vector Backbone:pSUPER; Vector Types:Mammalian Expression, RNAi; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19605556

Proper citation: RRID:Addgene_37211 Copy   

•   Source: Addgene

http://www.addgene.org/37173

Genetic Insert: ~5-kb BamHI + XhoI fragment from pUX2996 cloned into BamHI + SalI-cut pEXT20
Vector Backbone Description: Vector Backbone:pUX3025; Vector Types:; Bacterial Resistance:Ampicillin
Comments: This strain contains Roberts lab plasmid pUX3025 which contains ~5-kb BamHI + XhoI fragment from pUX2996 cloned into BamHI + SalI-cut pEXT20. Useful for mutagenesis and excision of the “e + f” binding region. For strain usage details see attached pdf. Please note that this strain has not been tested functionally by Addgene.

Proper citation: RRID:Addgene_37173 Copy   

•   Source: Addgene

http://www.addgene.org/37175

Genetic Insert: ~5-kb BamHI + XhoI fragment from pUX3010 cloned into BamHI + SalI-cut pEXT20
Vector Backbone Description: Vector Backbone:pUX3057; Vector Types:; Bacterial Resistance:Ampicillin
Comments: This strain contains Roberts lab plasmid pUX3057 which contains ~5-kb BamHI + XhoI fragment from pUX3010 cloned into BamHI + SalI-cut pEXT20. Useful for mutagenesis and excision of the “a-f” binding region. For strain usage details see attached pdf. Please note that Addgene has not tested this strain functionally.

Proper citation: RRID:Addgene_37175 Copy   

•   Source: Addgene

http://www.addgene.org/37206

Species: canine
Genetic Insert: dog ZO-1 shRNA
Vector Backbone Description: Backbone Size:3176; Vector Backbone:pSUPER; Vector Types:Mammalian Expression, RNAi; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19605556

Proper citation: RRID:Addgene_37206 Copy   

•   Source: Addgene

http://www.addgene.org/37200

Species: Mus musculus
Genetic Insert: Rosa26 left targeting arm
Vector Backbone Description: Backbone Marker:Sigma; Vector Backbone:pZDonor AAVS1; Vector Types:Genomic targeting - zinc finger; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22169954
Comments: The homology arms in the ROSA26 donor vector were generated by PCR of mouse genomic DNA and insertion of the PCR-amplified right homology arm (left primer: 5-TTATTGCGGCCGCAG ATGGGCGGGAGTCTTCT-3, right primer: 5-AACA CCGCGGCAGTTTATAAATGGAGAAAAAGGAGA -3) between the NotI and SacII sites and the left homology arm (left primer: 5-TCTATGGTACCAGTTAACGGCA GCCGGAGT-3 , right primer: 5 -CGGACGAATTCTCT AGAAAGACTGGAGTTGCAGA-3) between the KpnI and EcoRI sites in the pZDonor AAVS1 vector obtained from Sigma–Aldrich.

Proper citation: RRID:Addgene_37200 Copy   

•   Source: Addgene

http://www.addgene.org/37161

Species: Burkholderia xenovorans
Genetic Insert: rcoM2 in pEXT20
Vector Backbone Description: Vector Backbone:pEXT20; Vector Types:; Bacterial Resistance:Ampicillin
Defining Citation: PMID:18326575
Comments: This strain contains Roberts lab plasmid pUX2397 which contains an EcoRI-HindIII fragment bearing Burkholderia xenovorans LB400 rcoM2 cloned into pEXT20. Suitable for expression of Burkholderia xenovorans RcoM2 protein (untagged). Host strain is E. coli VJS6737. For strain usage see attached pdf.

Proper citation: RRID:Addgene_37161 Copy   

•   Source: Addgene