Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
| Plasmid Name | Proper Citation | Insert Name | Organism | Bacterial Resistance | Defining Citation |
Comments |
||||
|---|---|---|---|---|---|---|---|---|---|---|
|
pAAV-Ef1a-DO-hChR2(H134R)-mCherry-WPRE-pA Resource Report Resource Website 1+ mentions |
RRID:Addgene_37082 | hChr2(H134R)-mCherry | Synthetic | Ampicillin | PMID:22660328 | Backbone Marker:K. Deisseroth Lab; Backbone Size:5613; Vector Backbone:pAAV-Ef1a-DIO-hChR2(H134R)-mCherry-WPRE-pA; Vector Types:AAV, Cre/Lox, Cre-Off; Bacterial Resistance:Ampicillin | 2026-08-15 01:14:12 | 7 | ||
|
pAAV-Ef1a-DIO-mCherry-WPRE-pA Resource Report Resource Website 1+ mentions |
RRID:Addgene_37083 | mCherry | Synthetic | Ampicillin | PMID:22866029 | Backbone Marker:K. Deisseroth Lab; Backbone Size:5603; Vector Backbone:pAAV-Ef1a-DIO-hChR2(H134R)-mCherry-WPRE-pA; Vector Types:AAV, Cre/Lox, Cre-On; Bacterial Resistance:Ampicillin | 2026-08-15 01:14:12 | 6 | ||
|
pET15b-eIF4E Resource Report Resource Website |
RRID:Addgene_37228 | eIF4E | Saccharomyces cerevisiae | Ampicillin | PMID:20864040 | Backbone Marker:EMD bioscience; Backbone Size:5700; Vector Backbone:pET15b; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:14:13 | 0 | ||
|
pET15b-eIF4E-S200C Resource Report Resource Website |
RRID:Addgene_37229 | eIF4E | Saccharomyces cerevisiae | Ampicillin | PMID:20864040 | Backbone Marker:EMD bioscience; Backbone Size:5700; Vector Backbone:pET15b; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | S200C | 2026-08-15 01:14:13 | 0 | |
|
pUC19-HHtRNA Resource Report Resource Website |
RRID:Addgene_37222 | HHtRNA | Saccharomyces cerevisiae | Ampicillin | PMID:17913637 | HHtRNA sequence (rev orientation): TGGTAGCGCCGCTCGGTTTCGATCCGAGGACATCAGGGTTATGAGCCCTGCGCGCTTCCACTGCGCCACGGCGCTGACGGTACCGGGTACCGTTTCGTCCTCACGGACTCATCAGAGCG | Backbone Size:2686; Vector Backbone:pUC19; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:14:13 | 0 | |
|
pET PPL His6 MBP LIC cloning vector (2K-T) Resource Report Resource Website 1+ mentions |
RRID:Addgene_37183 | Ampicillin | This plasmid is an empty vector. Your gene can be inserted with a LIC cloning protocol. All 2-series vectors work as single-expression vectors, as well as transfer vectors for our polycistronic system. 2K-T has a TEV-cleavable N-terminal His6 and MBP fusion tag to enhance solubility and ease purification. These tags are preceded by a periplasmic locator signal, which is autocleaved during secretion. The PPL tag may be helpful if your protein binds to or interferes with intracellular E. coli molecules, since your protein of interest is safely sequestered in the periplasm. It may also be helpful if your protein of interest is more stable in the periplasmic environment. Protein purification may also be made simpler using this expression method. The LIC cloning site is flanked by 5 pairs of restriction sites, so that your gene can easily be subcloned into our polycistronic destination vectors (2D, 2E, or 2Z). To clone into this vector, add LIC v1 tags to the 5' end of your PCR primers. Forward - 5'TACTTCCAATCCAATGCA3' Reverse - 5'TTATCCACTTCCAATGTTATTA3' Linearize the plasmid with SspI and gel purify. When digesting the DNA with T4 polymerase, use dCTP for insert and dGTP for vector. More information on this vector can be found through http://qb3.berkeley.edu/qb3/macrolab/ | Backbone Size:6025; Vector Backbone:pET; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:14:13 | 3 | ||||
|
pCAG-T7-TALEN(Sangamo)-Destination Resource Report Resource Website 1+ mentions |
RRID:Addgene_37184 | Ampicillin | PMID:24747757 | For more information on Pelczar TALEN Add-On Plasmids please refer to: http://www.addgene.org/TALeffector/goldengate/add-ons/#pelczar | Backbone Marker:CLONTECH; Backbone Size:4810; Vector Backbone:pDIRECT; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:14:13 | 3 | |||
|
pSG5 EDD C2768A Resource Report Resource Website |
RRID:Addgene_37192 | EDD C2768A | Homo sapiens | Ampicillin | PMID:12011095 | The depositing lab has noted that mutation K503R shouldn’t be a problem as it is outside the main functional domains. There does appear to be a relatively common SNP at K503 in Latino populations so this might be a genuine SNP- http://exac.broadinstitute.org/variant/8-103338864-C-T https://www.ncbi.nlm.nih.gov/projects/SNP/snp_ref.cgi?rs=rs571861064 | Backbone Marker:Stratagene; Backbone Size:4225; Vector Backbone:pSG5; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | Changed Cysteine 2768 to Alanine; K503R (please see depositor comments below) | 2026-08-15 01:14:13 | 0 |
|
pTYB2-eIF1 Resource Report Resource Website |
RRID:Addgene_37217 | eIF1 | Saccharomyces cerevisiae | Ampicillin | PMID:17913637 | Backbone Marker:NEB; Backbone Size:7474; Vector Backbone:pTYB2; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:14:13 | 0 | ||
|
pTYB2-eIF5 Resource Report Resource Website |
RRID:Addgene_37219 | eIF5 | Saccharomyces cerevisiae | Ampicillin | PMID:17913637 | Backbone Marker:NEB; Backbone Size:7474; Vector Backbone:pTYB2; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:14:13 | 0 | ||
|
mZO1-1 shRNA Resource Report Resource Website 1+ mentions |
RRID:Addgene_37215 | mouse ZO-1 shRNA | Mus musculus | Ampicillin | pLL5.0 derived from pLL3.7; CMV promoter replaced with 5' LTR promoter from pMSCV. | Backbone Size:7700; Vector Backbone:pLL5.0; Vector Types:Mammalian Expression, RNAi; Bacterial Resistance:Ampicillin | 2026-08-15 01:14:13 | 1 | ||
|
mZO1-2 shRNA Resource Report Resource Website |
RRID:Addgene_37216 | mouse ZO-1 shRNA | Mus musculus | Ampicillin | pLL5.0 derived from pLL3.7; CMV promoter replaced with 5' LTR promoter from pMSCV. | Backbone Size:7700; Vector Backbone:pLL5.0; Vector Types:Mammalian Expression, RNAi; Bacterial Resistance:Ampicillin | 2026-08-15 01:14:13 | 0 | ||
|
UQ6106 Resource Report Resource Website |
RRID:Addgene_37176 | None | Ampicillin | This strain contains Roberts lab plasmid pUX3236 which is pUX2424 (contains ~1200bp fragment from Burkholderia xenovorans LB400 with introduced terminal HindIII and SalI sites [such that HindIII – (<-rcoM1– intergenic region – coxM1′->) – SalI]) but with a higher-affinity “e↑” binding site (5′-TCCTACAGTTCACGCACGT-3′). Suitable template for amplification and mutagenesis. For strain usage see attached pdf. Please note that this strain has not been confirmed by Addgene functionally. | Vector Backbone:pUX3236; Vector Types:; Bacterial Resistance:Ampicillin | 2026-08-15 01:14:13 | 0 | |||
|
ZO-2 shRNA 1320 Resource Report Resource Website |
RRID:Addgene_37210 | dog ZO-2 shRNA | canine | Ampicillin | PMID:19605556 | Backbone Size:3176; Vector Backbone:pSUPER; Vector Types:Mammalian Expression, RNAi; Bacterial Resistance:Ampicillin | 2026-08-15 01:14:13 | 0 | ||
|
ZO-2 shRNA 2434 Resource Report Resource Website |
RRID:Addgene_37211 | dog ZO-2 shRNA | canine | Ampicillin | PMID:19605556 | Backbone Size:3176; Vector Backbone:pSUPER; Vector Types:Mammalian Expression, RNAi; Bacterial Resistance:Ampicillin | 2026-08-15 01:14:13 | 0 | ||
|
UQ5784 Resource Report Resource Website |
RRID:Addgene_37173 | ~5-kb BamHI + XhoI fragment from pUX2996 cloned into BamHI + SalI-cut pEXT20 | Ampicillin | This strain contains Roberts lab plasmid pUX3025 which contains ~5-kb BamHI + XhoI fragment from pUX2996 cloned into BamHI + SalI-cut pEXT20. Useful for mutagenesis and excision of the “e + f” binding region. For strain usage details see attached pdf. Please note that this strain has not been tested functionally by Addgene. | Vector Backbone:pUX3025; Vector Types:; Bacterial Resistance:Ampicillin | 2026-08-15 01:14:13 | 0 | |||
|
UQ5828 Resource Report Resource Website |
RRID:Addgene_37175 | ~5-kb BamHI + XhoI fragment from pUX3010 cloned into BamHI + SalI-cut pEXT20 | Ampicillin | This strain contains Roberts lab plasmid pUX3057 which contains ~5-kb BamHI + XhoI fragment from pUX3010 cloned into BamHI + SalI-cut pEXT20. Useful for mutagenesis and excision of the “a-f” binding region. For strain usage details see attached pdf. Please note that Addgene has not tested this strain functionally. | Vector Backbone:pUX3057; Vector Types:; Bacterial Resistance:Ampicillin | 2026-08-15 01:14:13 | 0 | |||
|
ZO-1 shRNA 3253 Resource Report Resource Website 1+ mentions |
RRID:Addgene_37206 | dog ZO-1 shRNA | canine | Ampicillin | PMID:19605556 | Backbone Size:3176; Vector Backbone:pSUPER; Vector Types:Mammalian Expression, RNAi; Bacterial Resistance:Ampicillin | 2026-08-15 01:14:13 | 1 | ||
|
pDonor MCS Rosa26 Resource Report Resource Website 10+ mentions |
RRID:Addgene_37200 | Rosa26 left targeting arm | Mus musculus | Ampicillin | PMID:22169954 | The homology arms in the ROSA26 donor vector were generated by PCR of mouse genomic DNA and insertion of the PCR-amplified right homology arm (left primer: 5-TTATTGCGGCCGCAG ATGGGCGGGAGTCTTCT-3, right primer: 5-AACA CCGCGGCAGTTTATAAATGGAGAAAAAGGAGA -3) between the NotI and SacII sites and the left homology arm (left primer: 5-TCTATGGTACCAGTTAACGGCA GCCGGAGT-3 , right primer: 5 -CGGACGAATTCTCT AGAAAGACTGGAGTTGCAGA-3) between the KpnI and EcoRI sites in the pZDonor AAVS1 vector obtained from Sigma–Aldrich. | Backbone Marker:Sigma; Vector Backbone:pZDonor AAVS1; Vector Types:Genomic targeting - zinc finger; Bacterial Resistance:Ampicillin | 2026-08-15 01:14:13 | 10 | |
|
UQ4884 Resource Report Resource Website |
RRID:Addgene_37161 | rcoM2 in pEXT20 | Burkholderia xenovorans | Ampicillin | PMID:18326575 | This strain contains Roberts lab plasmid pUX2397 which contains an EcoRI-HindIII fragment bearing Burkholderia xenovorans LB400 rcoM2 cloned into pEXT20. Suitable for expression of Burkholderia xenovorans RcoM2 protein (untagged). Host strain is E. coli VJS6737. For strain usage see attached pdf. | Vector Backbone:pEXT20; Vector Types:; Bacterial Resistance:Ampicillin | 2026-08-15 01:14:13 | 0 |
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
