Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Danio rerio
Genetic Insert: apoA-Ia
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:3900; Vector Backbone:pCRII; Vector Types:; Bacterial Resistance:Ampicillin and Kanamycin
Defining Citation: PMID:25633982
Proper citation: RRID:Addgene_121895 Copy
Species: Danio rerio
Genetic Insert: ApoA1b
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:3973; Vector Backbone:pCRII; Vector Types:; Bacterial Resistance:Ampicillin and Kanamycin
Defining Citation: PMID:25633982
Proper citation: RRID:Addgene_121896 Copy
Species: Other
Genetic Insert: N-terminal fragment of Venus protein
Vector Backbone Description: Vector Backbone:pTOP-V2; Vector Types:tagging proteins in Cryptococcus neoformans; Bacterial Resistance:Ampicillin and Kanamycin
Defining Citation: PMID:27780958
Proper citation: RRID:Addgene_122435 Copy
Species: Other
Genetic Insert: C-terminal fragment of Venus protein
Vector Backbone Description: Vector Backbone:pTOP-V2; Vector Types:tagging proteins in Cryptococcus neoformans; Bacterial Resistance:Ampicillin and Kanamycin
Defining Citation: PMID:27780958
Proper citation: RRID:Addgene_122434 Copy
Species: Cryptococcus neoformans
Genetic Insert: N-terminal fragment of Venus protein
Vector Backbone Description: Vector Backbone:pTOP-V2; Vector Types:tagging proteins in Cryptococcus neoformans; Bacterial Resistance:Ampicillin and Kanamycin
Defining Citation: PMID:27780958
Proper citation: RRID:Addgene_122701 Copy
Species: Cryptococcus neoformans
Genetic Insert: C-terminal fragment of Venus protein
Vector Backbone Description: Vector Backbone:pTOP-V2; Vector Types:tagging proteins in Cryptococcus neoformans; Bacterial Resistance:Ampicillin and Kanamycin
Defining Citation: PMID:27780958
Proper citation: RRID:Addgene_122700 Copy
Species: Cricetulus griseus
Genetic Insert: Beta-(1,4)-Galactosyltransferase 1
Vector Backbone Description: Backbone Marker:Lucigen; Vector Backbone:pJAZZ; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin and Kanamycin
Defining Citation: PMID:31110306
Proper citation: RRID:Addgene_124633 Copy
Species: Cricetulus griseus
Genetic Insert: Alpha-(1,6)-fucosyltransferase
Vector Backbone Description: Backbone Marker:Lucigen; Vector Backbone:pJAZZ; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin and Kanamycin
Defining Citation: PMID:31110306
Proper citation: RRID:Addgene_124631 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: Hsp104 (K218T)
Vector Backbone Description: Backbone Size:0; Vector Backbone:pJC45S; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin and Kanamycin
Defining Citation: PMID:9674429
Comments: Addgene comment: Please note that the plasmid backbone does not match the pJC45 backbone. The depositor described this plasmid as having a "pJC45S" backbone. Full plasmid sequencing shows features similar to other yeast expression vectors. The lab is closed so were were unable to ask if this difference was intended.
Proper citation: RRID:Addgene_1250 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: Hsp104 (K620T)
Vector Backbone Description: Backbone Size:0; Vector Backbone:pJC45S; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin and Kanamycin
Defining Citation: PMID:9674429
Proper citation: RRID:Addgene_1251 Copy
Species: Other
Genetic Insert: promoter cassette containing ermE*p promoter and ampicillin resistance gene
Vector Backbone Description: Vector Backbone:pCAP03; Vector Types:Synthetic Biology; Bacterial Resistance:Ampicillin and Kanamycin
Defining Citation: PMID:30853419
Proper citation: RRID:Addgene_120234 Copy
Species: Synthetic
Genetic Insert: Tet-OsTIR1-loxP-PURO-loxP
Vector Backbone Description: Vector Backbone:unknown; Vector Types:CRISPR; Bacterial Resistance:Ampicillin and Kanamycin
Defining Citation: PMID:31026591
Comments: This plasmid is a variant of Addgene plasmid 72835.
Proper citation: RRID:Addgene_121185 Copy
Species: Homo sapiens
Genetic Insert: hsa-miR-1271-3p target
Vector Backbone Description: Vector Backbone:Low Sensor Backbone (LSB); Vector Types:Mammalian Expression, Synthetic Biology; Bacterial Resistance:Ampicillin and Kanamycin
Defining Citation: PMID:29934631
Comments: Please note that this plasmid is inherently unstable due to a repeating poly A element. We recommend performing a diagnostic digest on multiple colonies upon receipt. The depositors would like to note the presence of several discrepancies between the depositor sequence and physical plasmid sequence. In particular, the sequences upstream and downstream of the puromycin coding region have 10 bp insertions which do not affect the ability to perform puromycin selection. The sequences for those regions within the physical plasmids are as follows: Upstream of Puro: GAATTCGACCGCCTGTCTCAAGGTGCCACC; Downstream of Puro: GCTTTGAGACTACGCGTGAATTCACTCCTC.
Proper citation: RRID:Addgene_103195 Copy
Species: Homo sapiens
Genetic Insert: hsa-miR-1185-5p target
Vector Backbone Description: Vector Backbone:Low Sensor Backbone (LSB); Vector Types:Mammalian Expression, Synthetic Biology; Bacterial Resistance:Ampicillin and Kanamycin
Defining Citation: PMID:29934631
Comments: Please note that this plasmid is inherently unstable due to a repeating poly A element. We recommend performing a diagnostic digest on multiple colonies upon receipt. The depositors would like to note the presence of several discrepancies between the depositor sequence and physical plasmid sequence. In particular, the sequences upstream and downstream of the puromycin coding region have 10 bp insertions which do not affect the ability to perform puromycin selection. The sequences for those regions within the physical plasmids are as follows: Upstream of Puro: GAATTCGACCGCCTGTCTCAAGGTGCCACC; Downstream of Puro: GCTTTGAGACTACGCGTGAATTCACTCCTC.
Proper citation: RRID:Addgene_103182 Copy
Species: Homo sapiens
Genetic Insert: hsa-miR-10a-5p target
Vector Backbone Description: Vector Backbone:Low Sensor Backbone (LSB); Vector Types:Mammalian Expression, Synthetic Biology; Bacterial Resistance:Ampicillin and Kanamycin
Defining Citation: PMID:29934631
Comments: Please note that this plasmid is inherently unstable due to a repeating poly A element. We recommend performing a diagnostic digest on multiple colonies upon receipt. The depositors would like to note the presence of several discrepancies between the depositor sequence and physical plasmid sequence. In particular, the sequences upstream and downstream of the puromycin coding region have 10 bp insertions which do not affect the ability to perform puromycin selection. The sequences for those regions within the physical plasmids are as follows: Upstream of Puro: GAATTCGACCGCCTGTCTCAAGGTGCCACC; Downstream of Puro: GCTTTGAGACTACGCGTGAATTCACTCCTC.
Proper citation: RRID:Addgene_103177 Copy
Species: Homo sapiens
Genetic Insert: hsa-miR-125b-2-3p target
Vector Backbone Description: Vector Backbone:Low Sensor Backbone (LSB); Vector Types:Mammalian Expression, Synthetic Biology; Bacterial Resistance:Ampicillin and Kanamycin
Defining Citation: PMID:29934631
Comments: Please note that this plasmid is inherently unstable due to a repeating poly A element. We recommend performing a diagnostic digest on multiple colonies upon receipt. The depositors would like to note the presence of several discrepancies between the depositor sequence and physical plasmid sequence. In particular, the sequences upstream and downstream of the puromycin coding region have 10 bp insertions which do not affect the ability to perform puromycin selection. The sequences for those regions within the physical plasmids are as follows: Upstream of Puro: GAATTCGACCGCCTGTCTCAAGGTGCCACC; Downstream of Puro: GCTTTGAGACTACGCGTGAATTCACTCCTC.
Proper citation: RRID:Addgene_103190 Copy
Species: Homo sapiens
Genetic Insert: hsa-miR-126-5p target
Vector Backbone Description: Vector Backbone:Low Sensor Backbone (LSB); Vector Types:Mammalian Expression, Synthetic Biology; Bacterial Resistance:Ampicillin and Kanamycin
Defining Citation: PMID:29934631
Comments: Please note that this plasmid is inherently unstable due to a repeating poly A element. We recommend performing a diagnostic digest on multiple colonies upon receipt. The depositors would like to note the presence of several discrepancies between the depositor sequence and physical plasmid sequence. In particular, the sequences upstream and downstream of the puromycin coding region have 10 bp insertions which do not affect the ability to perform puromycin selection. The sequences for those regions within the physical plasmids are as follows: Upstream of Puro: GAATTCGACCGCCTGTCTCAAGGTGCCACC; Downstream of Puro: GCTTTGAGACTACGCGTGAATTCACTCCTC.
Proper citation: RRID:Addgene_103193 Copy
Species: Homo sapiens
Genetic Insert: hsa-miR-125a-5p target
Vector Backbone Description: Vector Backbone:Low Sensor Backbone (LSB); Vector Types:Mammalian Expression, Synthetic Biology; Bacterial Resistance:Ampicillin and Kanamycin
Defining Citation: PMID:29934631
Comments: Please note that this plasmid is inherently unstable due to a repeating poly A element. We recommend performing a diagnostic digest on multiple colonies upon receipt. The depositors would like to note the presence of several discrepancies between the depositor sequence and physical plasmid sequence. In particular, the sequences upstream and downstream of the puromycin coding region have 10 bp insertions which do not affect the ability to perform puromycin selection. The sequences for those regions within the physical plasmids are as follows: Upstream of Puro: GAATTCGACCGCCTGTCTCAAGGTGCCACC; Downstream of Puro: GCTTTGAGACTACGCGTGAATTCACTCCTC.
Proper citation: RRID:Addgene_103188 Copy
Species: Homo sapiens
Genetic Insert: hsa-miR-125b-1-3p target
Vector Backbone Description: Vector Backbone:Low Sensor Backbone (LSB); Vector Types:Mammalian Expression, Synthetic Biology; Bacterial Resistance:Ampicillin and Kanamycin
Defining Citation: PMID:29934631
Comments: Please note that this plasmid is inherently unstable due to a repeating poly A element. We recommend performing a diagnostic digest on multiple colonies upon receipt. The depositors would like to note the presence of several discrepancies between the depositor sequence and physical plasmid sequence. In particular, the sequences upstream and downstream of the puromycin coding region have 10 bp insertions which do not affect the ability to perform puromycin selection. The sequences for those regions within the physical plasmids are as follows: Upstream of Puro: GAATTCGACCGCCTGTCTCAAGGTGCCACC; Downstream of Puro: GCTTTGAGACTACGCGTGAATTCACTCCTC.
Proper citation: RRID:Addgene_103189 Copy
Species: Homo sapiens
Genetic Insert: hsa-miR-122a-5p target
Vector Backbone Description: Vector Backbone:Low Sensor Backbone (LSB); Vector Types:Mammalian Expression, Synthetic Biology; Bacterial Resistance:Ampicillin and Kanamycin
Defining Citation: PMID:29934631
Comments: Please note that this plasmid is inherently unstable due to a repeating poly A element. We recommend performing a diagnostic digest on multiple colonies upon receipt. The depositors would like to note the presence of several discrepancies between the depositor sequence and physical plasmid sequence. In particular, the sequences upstream and downstream of the puromycin coding region have 10 bp insertions which do not affect the ability to perform puromycin selection. The sequences for those regions within the physical plasmids are as follows: Upstream of Puro: GAATTCGACCGCCTGTCTCAAGGTGCCACC; Downstream of Puro: GCTTTGAGACTACGCGTGAATTCACTCCTC.
Proper citation: RRID:Addgene_103183 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within RRID that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
