Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: E. coli
Genetic Insert: Encodes the hybrid receptor of E. coli chemoreceptor Tar and histidine kinase CitA: CitA[1-193]-Tar[204-553]
Vector Backbone Description: Backbone Size:4211; Vector Backbone:pKG116; Vector Types:; Bacterial Resistance:Chloramphenicol
Defining Citation: PMID:27285081
Proper citation: RRID:Addgene_82037 Copy
Species: E. coli, P. putida
Genetic Insert: Encodes the hybrid receptor of E. coli chemoreceptor Tar and P. putida chemoreceptor McpS: McpS[1-295]-Tar[200-553]
Vector Backbone Description: Backbone Size:4211; Vector Backbone:pKG116; Vector Types:; Bacterial Resistance:Chloramphenicol
Defining Citation: PMID:27285081
Proper citation: RRID:Addgene_82039 Copy
Species: E. coli, B. subtilis
Genetic Insert: Encodes the hybrid receptor of E. coli chemoreceptor Tar and B. subtilis chemoreceptor McpC: McpC[1-350]-Tar[267-553]
Vector Backbone Description: Backbone Size:4211; Vector Backbone:pKG116; Vector Types:; Bacterial Resistance:Chloramphenicol
Defining Citation: PMID:27285081
Proper citation: RRID:Addgene_82027 Copy
Species: E. coli
Genetic Insert: Encodes the hybrid receptor of E. coli chemoreceptor Tar and histidine kinase NarQ: NarQ[1-217]-Tar[257-553]
Vector Backbone Description: Backbone Size:4211; Vector Backbone:pKG116; Vector Types:; Bacterial Resistance:Chloramphenicol
Defining Citation: PMID:27285081
Proper citation: RRID:Addgene_82040 Copy
Genetic Insert: TP901-1 integrase
Vector Backbone Description: Backbone Size:2200; Vector Backbone:ColE1; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Chloramphenicol
Defining Citation: PMID:27193783
Comments: This plasmid is exactly the Dual-recombinase-controller (Addgene 44456) from Bonnet et al, with the addition of a constitutive wild type tetR gene.
Proper citation: RRID:Addgene_82351 Copy
Species: Synthetic
Genetic Insert: mCherry
Vector Backbone Description: Vector Backbone:pJPC12; Vector Types:Bacterial Expression; Bacterial Resistance:Chloramphenicol
Defining Citation: PMID:27982027
Comments: The pJPC12 vector was obtained from Peterson and Phillips (Peterson, J. and G.J. Phillips, New pSC101-derivative cloning vectors with elevated copy numbers. Plasmid, 2008. 59(3): p. 193-201)
Proper citation: RRID:Addgene_80859 Copy
Species: Synthetic
Genetic Insert: mCherry
Vector Backbone Description: Vector Backbone:pJPC12; Vector Types:Bacterial Expression; Bacterial Resistance:Chloramphenicol
Defining Citation: PMID:27982027
Comments: The pJPC12 vector was obtained from Peterson and Phillips (Peterson, J. and G.J. Phillips, New pSC101-derivative cloning vectors with elevated copy numbers. Plasmid, 2008. 59(3): p. 193-201)
Proper citation: RRID:Addgene_80914 Copy
Species: Synthetic
Genetic Insert: mCherry
Vector Backbone Description: Vector Backbone:pJPC12; Vector Types:Bacterial Expression; Bacterial Resistance:Chloramphenicol
Defining Citation: PMID:27982027
Comments: The pJPC12 vector was obtained from Peterson and Phillips (Peterson, J. and G.J. Phillips, New pSC101-derivative cloning vectors with elevated copy numbers. Plasmid, 2008. 59(3): p. 193-201)
Proper citation: RRID:Addgene_80913 Copy
Species: Synthetic
Genetic Insert: mCherry
Vector Backbone Description: Vector Backbone:pJPC12; Vector Types:Bacterial Expression; Bacterial Resistance:Chloramphenicol
Defining Citation: PMID:27982027
Comments: The pJPC12 vector was obtained from Peterson and Phillips (Peterson, J. and G.J. Phillips, New pSC101-derivative cloning vectors with elevated copy numbers. Plasmid, 2008. 59(3): p. 193-201)
Proper citation: RRID:Addgene_80912 Copy
Species: Mus musculus
Genetic Insert: TET1
Vector Backbone Description: Backbone Marker:Novagen; Backbone Size:4008; Vector Backbone:pACYCDuet-1; Vector Types:Bacterial Expression; Bacterial Resistance:Chloramphenicol
Defining Citation: PMID:26932196
Proper citation: RRID:Addgene_81056 Copy
Species: E. coli, B. subtilis
Genetic Insert: Encodes the hybrid receptor of E. coli chemoreceptor Tar and B. subtilis chemoreceptor McpC: Tar[1-43]-McpC[49-270]-Tar[184-553]
Vector Backbone Description: Backbone Size:4211; Vector Backbone:pKG116; Vector Types:Bacterial Expression; Bacterial Resistance:Chloramphenicol
Defining Citation: PMID:27285081
Proper citation: RRID:Addgene_81227 Copy
Species: Desulfovibrio vulgaris str. Hildenborough
Genetic Insert: Synthetic CRISPR array (3 copies of D. vulgaris spacer #2 flanked by repeats)
Vector Backbone Description: Backbone Marker:Novagen; Backbone Size:4008; Vector Backbone:pACYCDuet-1; Vector Types:Bacterial Expression, CRISPR; Bacterial Resistance:Chloramphenicol
Defining Citation: PMID:27588603
Comments: Spacer sequence: GCCATGCTCAGGCTGGCGAGTGCGCCACTCATCAA
Repeat sequence: GTCGCCCCCCACGCGGGGGCGTGGATTGAAAC
Proper citation: RRID:Addgene_81186 Copy
Species: Synthetic
Genetic Insert: TEM-1 beta-lactamase
Vector Backbone Description: Backbone Size:3224; Vector Backbone:pSALECT; Vector Types:Bacterial Expression; Bacterial Resistance:Chloramphenicol
Defining Citation: PMID:28196882
Proper citation: RRID:Addgene_81163 Copy
Species: E. coli
Genetic Insert: folA
Vector Backbone Description: Backbone Marker:Novagen; Vector Backbone:pACYCDuet-1; Vector Types:Bacterial Expression; Bacterial Resistance:Chloramphenicol
Defining Citation: PMID:31189117
Proper citation: RRID:Addgene_91229 Copy
Species: E.coli
Genetic Insert: folA
Vector Backbone Description: Backbone Marker:Novagen; Vector Backbone:pACYCDuet-1; Vector Types:Bacterial Expression; Bacterial Resistance:Chloramphenicol
Defining Citation: PMID:31189117
Proper citation: RRID:Addgene_91226 Copy
Species: E. coli
Genetic Insert: folA
Vector Backbone Description: Backbone Marker:Novagen; Vector Backbone:pACYCDuet-1; Vector Types:Bacterial Expression; Bacterial Resistance:Chloramphenicol
Defining Citation: PMID:31189117
Proper citation: RRID:Addgene_91227 Copy
Species: E. coli
Genetic Insert: folA
Vector Backbone Description: Backbone Marker:Novagen; Vector Backbone:pACYCDuet-1; Vector Types:Bacterial Expression; Bacterial Resistance:Chloramphenicol
Defining Citation: PMID:31189117
Proper citation: RRID:Addgene_91244 Copy
Species: E. coli
Genetic Insert: folA
Vector Backbone Description: Backbone Marker:Novagen; Vector Backbone:pACYCDuet-1; Vector Types:Bacterial Expression; Bacterial Resistance:Chloramphenicol
Defining Citation: PMID:31189117
Proper citation: RRID:Addgene_91242 Copy
Species: E. coli
Genetic Insert: folA
Vector Backbone Description: Backbone Marker:Novagen; Vector Backbone:pACYCDuet-1; Vector Types:Bacterial Expression; Bacterial Resistance:Chloramphenicol
Defining Citation: PMID:31189117
Proper citation: RRID:Addgene_91243 Copy
Species: E. coli
Genetic Insert: folA
Vector Backbone Description: Backbone Marker:Novagen; Vector Backbone:pACYCDuet-1; Vector Types:Bacterial Expression; Bacterial Resistance:Chloramphenicol
Defining Citation: PMID:31189117
Proper citation: RRID:Addgene_91240 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within RRID that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
