Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Preparing word cloud

×

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search
Reset search
Filter by records added date

See new records

Options

Current Facets and Filters

  • Organism:arabidopsis thaliana (facet)

Recent searches

Snippet view Table view

Can't find the RRID you're searching for? X
Click the to add this resource to a Collection

2,244 Results - per page

Show More Columns | Download Top 1000 Results

Plasmid Name

Sort Ascending

Sort Descending

 Proper Citation

Sort Ascending

Sort Descending

 Insert Name

Sort Ascending

Sort Descending

 Organism

Sort Ascending

Sort Descending

 Bacterial Resistance

Sort Ascending

Sort Descending

 Defining Citation

Sort Ascending

Sort Descending

 Comments
Vector Backbone Description
Relevant Mutation
Record Last Update

Sort Ascending

Sort Descending

 Mentions Count

Sort Ascending

Sort Descending
pSTTa-GPA1
 
Resource Report
Resource Website 		RRID:Addgene_248648 GPA1 Arabidopsis thaliana Ampicillin PMID:40260404 Backbone Marker:GE Healthcare; Backbone Size:4523; Vector Backbone:pSTTa (from pGEX); Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:34:50 0
pSTTa-GPA1-S52N
 
Resource Report
Resource Website 		RRID:Addgene_248649 GPA1 Arabidopsis thaliana Ampicillin PMID:40260404 Additional details regarding the physiological roles of this mutant GPA1 protein can be found at PMID: 31690635. Backbone Marker:GE Healthcare; Backbone Size:4523; Vector Backbone:pSTTa (from pGEX); Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin S52N 2026-08-15 01:34:52 0
pICSL30043
 
Resource Report
Resource Website 		RRID:Addgene_245548 N-Terminal tag Sv40 Nuclear Localization Signal (MASSPPKKKRKVSWKM) Arabidopsis thaliana Spectinomycin Level 0 N-Terminal tag module used for GoldenGate assemblies using the MoClo overhang syntax Backbone Size:2246; Vector Backbone:pICSL01002; Vector Types:Synthetic Biology; Bacterial Resistance:Spectinomycin BsaI/BpiI sites removed by point-mutation 2026-08-15 01:35:00 0
PCO4SV40_pDONR201
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_249815 PCO4 Arabidopsis thaliana Kanamycin Please visit https://doi.org/10.1101/2025.09.01.673502 for the bioRxiv preprint. Backbone Marker:Thermo Fisher scientific; Backbone Size:2040; Vector Backbone:pDONR201; Vector Types:Gateway Cloning; Bacterial Resistance:Kanamycin 2026-08-15 01:35:01 1
pZZ006-AlcA::DM2h[Bla-1] S111A H112A-Myc
 
Resource Report
Resource Website 		RRID:Addgene_246382 DM2h[Bla-1] Arabidopsis thaliana Spectinomycin Vector Backbone:pZZ006; Vector Types:Plant Expression; Bacterial Resistance:Spectinomycin CCATTCTTAGTCACATCCTCGAA to AAAACCATTCTTGCTGCTATCCTCGAA amino acid S111A H112A 2026-08-15 01:35:44 0
pBi2FC-N-MPK12-P2A:mCherry
 
Resource Report
Resource Website 		RRID:Addgene_216139 MPK12 Arabidopsis thaliana Spectinomycin PMID:39100877 Please visit https://www.biorxiv.org/content/10.1101/2024.06.28.601222v1.full for bioRxiv preprint. Vector Backbone:pGWB502-omega; Vector Types:Plant Expression; Bacterial Resistance:Spectinomycin 2026-08-15 01:29:53 0
pBi2FC-N-MPK5-P2A:mCherry
 
Resource Report
Resource Website 		RRID:Addgene_216136 MPK5 Arabidopsis thaliana Spectinomycin PMID:39100877 Addgene NGS results found E483G mutation in insert ORF that does not impact plasmid function. Please visit https://www.biorxiv.org/content/10.1101/2024.06.28.601222v1.full for bioRxiv preprint. Vector Backbone:pGWB502-omega; Vector Types:Plant Expression; Bacterial Resistance:Spectinomycin 2026-08-15 01:29:51 0
pST_DHN_AtCor47 (pBS0784)
 
Resource Report
Resource Website 		RRID:Addgene_185254 DHN_AtCor47 Arabidopsis thaliana Ampicillin PMID:35176859 This is one of the bottom performing targets in our apoptosis assay (it induced apoptosis). See supplemental table 2 in our paper to see its performance in our assay. The negative control for this assay is pSecTag2 B which can be obtained from Thermo here https://www.thermofisher.com/order/catalog/product/V90020 Vector Backbone:YK 02; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:23:06 0
PHR-GFP-FUSN
 
Resource Report
Resource Website 		RRID:Addgene_183932 PHR-GFP-FUSN Arabidopsis thaliana Kanamycin PMID:35537448 Backbone Marker:Clontech; Vector Backbone:pmCherryN1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin none 2026-08-15 01:23:09 0
PHR-GFP-FUSN-VP16
 
Resource Report
Resource Website 		RRID:Addgene_183933 PHR-GFP-FUSN-VP16 Arabidopsis thaliana Kanamycin PMID:35537448 Backbone Marker:Clontech; Vector Backbone:pmCherryN1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin none 2026-08-15 01:23:09 0
NLS-tdPCP-CIBN
 
Resource Report
Resource Website 		RRID:Addgene_183937 tdPCP-CIBN Arabidopsis thaliana Kanamycin PMID:35537448 under control of the weakened deltaTATA-CMV promoter for low level expression Backbone Marker:Addgene #54642; Backbone Size:4592; Vector Backbone:tdTomato-N1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin none 2026-08-15 01:23:09 0
CIBN-rTetR
 
Resource Report
Resource Website 		RRID:Addgene_183919 CIBN-rTetR Arabidopsis thaliana Kanamycin PMID:35537448 Backbone Marker:Clontech; Vector Backbone:pEGFP-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin none 2026-08-15 01:23:09 0
PHR-GFP-p65
 
Resource Report
Resource Website 		RRID:Addgene_183929 PHR-GFP-p65 Arabidopsis thaliana Kanamycin PMID:35537448 Backbone Marker:Clontech; Vector Backbone:pmCherryN1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin none 2026-08-15 01:23:09 0
PHR-GFP
 
Resource Report
Resource Website 		RRID:Addgene_183926 PHR-GFP Arabidopsis thaliana Kanamycin PMID:35537448 Backbone Marker:Clontech; Vector Backbone:pmCherryN1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin none 2026-08-15 01:23:09 0
PHR-GFP-Rta
 
Resource Report
Resource Website 		RRID:Addgene_183930 PHR-GFP-Rta Arabidopsis thaliana Kanamycin PMID:35537448 Backbone Marker:Clontech; Vector Backbone:pmCherryN1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin none 2026-08-15 01:23:16 0
PHR-GFP-STAT2
 
Resource Report
Resource Website 		RRID:Addgene_183931 PHR-GFP-STAT2 Arabidopsis thaliana Kanamycin PMID:35537448 Backbone Marker:Clontech; Vector Backbone:pmCherryN1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin none 2026-08-15 01:23:16 0
1BR9-AtWUSSTOP-Δα3
 
Resource Report
Resource Website 		RRID:Addgene_202056 AtWUS E. Coli Codon Optimized, third helix of homeodomain deleted Arabidopsis thaliana Kanamycin PMID:37573467 Please visit https://www.biorxiv.org/content/10.1101/2022.05.03.490515v2 for bioRxiv preprint. Backbone Size:5513; Vector Backbone:1BR9; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin third helix of homeodomain deleted (AA82-102) 2026-08-15 01:27:52 0
pROF366
 
Resource Report
Resource Website 		RRID:Addgene_155332 PAtAP1-FLuc-TSV40 Arabidopsis thaliana Ampicillin PMID:32601426 Vector Backbone:pKM081; Vector Types:Plant Expression, Luciferase, Synthetic Biology; Bacterial Resistance:Ampicillin 2026-08-15 01:28:01 0
pETM6-At4CL-CmCHS-CmCHI
 
Resource Report
Resource Website 		RRID:Addgene_73395 At4CL Arabidopsis thaliana Ampicillin PMID:26860871 Backbone Marker:Koffas Lab, Addgene Plasmid #49795; Backbone Size:5203; Vector Backbone:pETM6; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:19:28 0
pETM6-At4CL-PhCHS-CmCHI
 
Resource Report
Resource Website 		RRID:Addgene_73393 At4CL Arabidopsis thaliana Ampicillin PMID:26860871 Backbone Marker:Koffas Lab, Addgene Plasmid #49795; Backbone Size:5203; Vector Backbone:pETM6; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:19:28 0

Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
X

  1. RRID Portal Resources

    Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search

  5. Collections

    If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  6. Facets

    Here are the facets that you can filter the data by.

  7. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

About

Welcome to the Resource Identification Portal Community.

Please see Force11 for more detailed information

We thank the NIH for their support of the RRID portal Award# R24GM144308, U24DK097771, U24DA039832, HHSN276201700124P, 75N97021P00135

Recent News Entries

Contact Us

Our Information

rii-help *at* scicrunch.org

About SciCrunch | Privacy Policy | Terms of Service

SciCrunch