Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
| Plasmid Name | Proper Citation | Insert Name | Organism | Bacterial Resistance | Defining Citation |
Comments |
||||
|---|---|---|---|---|---|---|---|---|---|---|
|
pSTTa-GPA1 Resource Report Resource Website |
RRID:Addgene_248648 | GPA1 | Arabidopsis thaliana | Ampicillin | PMID:40260404 | Backbone Marker:GE Healthcare; Backbone Size:4523; Vector Backbone:pSTTa (from pGEX); Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:34:50 | 0 | ||
|
pSTTa-GPA1-S52N Resource Report Resource Website |
RRID:Addgene_248649 | GPA1 | Arabidopsis thaliana | Ampicillin | PMID:40260404 | Additional details regarding the physiological roles of this mutant GPA1 protein can be found at PMID: 31690635. | Backbone Marker:GE Healthcare; Backbone Size:4523; Vector Backbone:pSTTa (from pGEX); Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | S52N | 2026-08-15 01:34:52 | 0 |
|
pICSL30043 Resource Report Resource Website |
RRID:Addgene_245548 | N-Terminal tag Sv40 Nuclear Localization Signal (MASSPPKKKRKVSWKM) | Arabidopsis thaliana | Spectinomycin | Level 0 N-Terminal tag module used for GoldenGate assemblies using the MoClo overhang syntax | Backbone Size:2246; Vector Backbone:pICSL01002; Vector Types:Synthetic Biology; Bacterial Resistance:Spectinomycin | BsaI/BpiI sites removed by point-mutation | 2026-08-15 01:35:00 | 0 | |
|
PCO4SV40_pDONR201 Resource Report Resource Website 1+ mentions |
RRID:Addgene_249815 | PCO4 | Arabidopsis thaliana | Kanamycin | Please visit https://doi.org/10.1101/2025.09.01.673502 for the bioRxiv preprint. | Backbone Marker:Thermo Fisher scientific; Backbone Size:2040; Vector Backbone:pDONR201; Vector Types:Gateway Cloning; Bacterial Resistance:Kanamycin | 2026-08-15 01:35:01 | 1 | ||
|
pZZ006-AlcA::DM2h[Bla-1] S111A H112A-Myc Resource Report Resource Website |
RRID:Addgene_246382 | DM2h[Bla-1] | Arabidopsis thaliana | Spectinomycin | Vector Backbone:pZZ006; Vector Types:Plant Expression; Bacterial Resistance:Spectinomycin | CCATTCTTAGTCACATCCTCGAA to AAAACCATTCTTGCTGCTATCCTCGAA amino acid S111A H112A | 2026-08-15 01:35:44 | 0 | ||
|
pBi2FC-N-MPK12-P2A:mCherry Resource Report Resource Website |
RRID:Addgene_216139 | MPK12 | Arabidopsis thaliana | Spectinomycin | PMID:39100877 | Please visit https://www.biorxiv.org/content/10.1101/2024.06.28.601222v1.full for bioRxiv preprint. | Vector Backbone:pGWB502-omega; Vector Types:Plant Expression; Bacterial Resistance:Spectinomycin | 2026-08-15 01:29:53 | 0 | |
|
pBi2FC-N-MPK5-P2A:mCherry Resource Report Resource Website |
RRID:Addgene_216136 | MPK5 | Arabidopsis thaliana | Spectinomycin | PMID:39100877 | Addgene NGS results found E483G mutation in insert ORF that does not impact plasmid function. Please visit https://www.biorxiv.org/content/10.1101/2024.06.28.601222v1.full for bioRxiv preprint. | Vector Backbone:pGWB502-omega; Vector Types:Plant Expression; Bacterial Resistance:Spectinomycin | 2026-08-15 01:29:51 | 0 | |
|
pST_DHN_AtCor47 (pBS0784) Resource Report Resource Website |
RRID:Addgene_185254 | DHN_AtCor47 | Arabidopsis thaliana | Ampicillin | PMID:35176859 | This is one of the bottom performing targets in our apoptosis assay (it induced apoptosis). See supplemental table 2 in our paper to see its performance in our assay. The negative control for this assay is pSecTag2 B which can be obtained from Thermo here https://www.thermofisher.com/order/catalog/product/V90020 | Vector Backbone:YK 02; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:23:06 | 0 | |
|
PHR-GFP-FUSN Resource Report Resource Website |
RRID:Addgene_183932 | PHR-GFP-FUSN | Arabidopsis thaliana | Kanamycin | PMID:35537448 | Backbone Marker:Clontech; Vector Backbone:pmCherryN1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin | none | 2026-08-15 01:23:09 | 0 | |
|
PHR-GFP-FUSN-VP16 Resource Report Resource Website |
RRID:Addgene_183933 | PHR-GFP-FUSN-VP16 | Arabidopsis thaliana | Kanamycin | PMID:35537448 | Backbone Marker:Clontech; Vector Backbone:pmCherryN1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin | none | 2026-08-15 01:23:09 | 0 | |
|
NLS-tdPCP-CIBN Resource Report Resource Website |
RRID:Addgene_183937 | tdPCP-CIBN | Arabidopsis thaliana | Kanamycin | PMID:35537448 | under control of the weakened deltaTATA-CMV promoter for low level expression | Backbone Marker:Addgene #54642; Backbone Size:4592; Vector Backbone:tdTomato-N1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin | none | 2026-08-15 01:23:09 | 0 |
|
CIBN-rTetR Resource Report Resource Website |
RRID:Addgene_183919 | CIBN-rTetR | Arabidopsis thaliana | Kanamycin | PMID:35537448 | Backbone Marker:Clontech; Vector Backbone:pEGFP-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin | none | 2026-08-15 01:23:09 | 0 | |
|
PHR-GFP-p65 Resource Report Resource Website |
RRID:Addgene_183929 | PHR-GFP-p65 | Arabidopsis thaliana | Kanamycin | PMID:35537448 | Backbone Marker:Clontech; Vector Backbone:pmCherryN1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin | none | 2026-08-15 01:23:09 | 0 | |
|
PHR-GFP Resource Report Resource Website |
RRID:Addgene_183926 | PHR-GFP | Arabidopsis thaliana | Kanamycin | PMID:35537448 | Backbone Marker:Clontech; Vector Backbone:pmCherryN1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin | none | 2026-08-15 01:23:09 | 0 | |
|
PHR-GFP-Rta Resource Report Resource Website |
RRID:Addgene_183930 | PHR-GFP-Rta | Arabidopsis thaliana | Kanamycin | PMID:35537448 | Backbone Marker:Clontech; Vector Backbone:pmCherryN1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin | none | 2026-08-15 01:23:16 | 0 | |
|
PHR-GFP-STAT2 Resource Report Resource Website |
RRID:Addgene_183931 | PHR-GFP-STAT2 | Arabidopsis thaliana | Kanamycin | PMID:35537448 | Backbone Marker:Clontech; Vector Backbone:pmCherryN1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin | none | 2026-08-15 01:23:16 | 0 | |
|
1BR9-AtWUSSTOP-Δα3 Resource Report Resource Website |
RRID:Addgene_202056 | AtWUS E. Coli Codon Optimized, third helix of homeodomain deleted | Arabidopsis thaliana | Kanamycin | PMID:37573467 | Please visit https://www.biorxiv.org/content/10.1101/2022.05.03.490515v2 for bioRxiv preprint. | Backbone Size:5513; Vector Backbone:1BR9; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin | third helix of homeodomain deleted (AA82-102) | 2026-08-15 01:27:52 | 0 |
|
pROF366 Resource Report Resource Website |
RRID:Addgene_155332 | PAtAP1-FLuc-TSV40 | Arabidopsis thaliana | Ampicillin | PMID:32601426 | Vector Backbone:pKM081; Vector Types:Plant Expression, Luciferase, Synthetic Biology; Bacterial Resistance:Ampicillin | 2026-08-15 01:28:01 | 0 | ||
|
pETM6-At4CL-CmCHS-CmCHI Resource Report Resource Website |
RRID:Addgene_73395 | At4CL | Arabidopsis thaliana | Ampicillin | PMID:26860871 | Backbone Marker:Koffas Lab, Addgene Plasmid #49795; Backbone Size:5203; Vector Backbone:pETM6; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:19:28 | 0 | ||
|
pETM6-At4CL-PhCHS-CmCHI Resource Report Resource Website |
RRID:Addgene_73393 | At4CL | Arabidopsis thaliana | Ampicillin | PMID:26860871 | Backbone Marker:Koffas Lab, Addgene Plasmid #49795; Backbone Size:5203; Vector Backbone:pETM6; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:19:28 | 0 |
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.