Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Schmidtea mediterranea
Genetic Insert: nemo-like kinase (also known as h.109.4e) in situ probe
Vector Backbone Description: Backbone Marker:Phillip Newmark (Addgene plasmid # 26536); Backbone Size:3240; Vector Backbone:pJC53.2; Vector Types:T/A Cloning Vector for dsRNA generation and the generation of sense and anti-sense probes; Bacterial Resistance:Ampicillin and Kanamycin
Defining Citation: PMID:23297191
Comments: Cloning primers: F-CAAATGGTTGTTACGCTCCA R-GACATGGTCGACTGACAACG
Proper citation: RRID:Addgene_99082 Copy
Species: Schmidtea mediterranea
Genetic Insert: Unc-9 (also known as h.26.12f) in situ probe
Vector Backbone Description: Backbone Marker:Phillip Newmark (Addgene plasmid # 26536); Backbone Size:3240; Vector Backbone:pJC53.2; Vector Types:T/A Cloning Vector for dsRNA generation and the generation of sense and anti-sense probes; Bacterial Resistance:Ampicillin and Kanamycin
Defining Citation: PMID:23297191
Comments: Cloning primers: F-TGTAGCTTTTTCCGGGAATTT, R-TACAATGCGTATTGCCGTTG
Proper citation: RRID:Addgene_99084 Copy
Species: Schmidtea mediterranea
Genetic Insert: Runt-1 (also known as runt) in situ probe
Vector Backbone Description: Backbone Marker:Phillip Newmark (Addgene plasmid # 26536); Backbone Size:3240; Vector Backbone:pJC53.2; Vector Types:T/A Cloning Vector for dsRNA generation and the generation of sense and anti-sense probes; Bacterial Resistance:Ampicillin and Kanamycin
Defining Citation: PMID:27612384
Comments: Cloning primers: F-AGTCGCAGTGGAAGAGGAAA, R-TGATGGGATTGCGAGTTGTA
Proper citation: RRID:Addgene_99089 Copy
Species: Schmidtea mediterranea
Genetic Insert: notum in situ probe
Vector Backbone Description: Backbone Marker:Phillip Newmark (Addgene plasmid # 26536); Backbone Size:3240; Vector Backbone:pJC53.2; Vector Types:T/A Cloning Vector for dsRNA generation and the generation of sense and anti-sense probes; Bacterial Resistance:Ampicillin and Kanamycin
Defining Citation: PMID:23297191
Comments: Note: The notum insert contains several mismatches compared to JF725701.1. The depositor has confirmed this does not affect plasmid function.
Proper citation: RRID:Addgene_99067 Copy
Species: Schmidtea mediterranea
Genetic Insert: ChAT (choline acetyltransferase) in situ probe
Vector Backbone Description: Backbone Marker:Phillip Newmark (Addgene plasmid # 26536); Backbone Size:3240; Vector Backbone:pJC53.2; Vector Types:T/A Cloning Vector for dsRNA generation and the generation of sense and anti-sense probes; Bacterial Resistance:Ampicillin and Kanamycin
Defining Citation: PMID:23297191
Comments: Cloning primers: F-GATCTCCTGCCACCAAAGAA, R-AACTCCATGACCCTGAATCG
Proper citation: RRID:Addgene_99069 Copy
Species: Schmidtea mediterranea
Genetic Insert: foxD in situ probe
Vector Backbone Description: Backbone Marker:Phillip Newmark (Addgene plasmid # 26536); Backbone Size:3240; Vector Backbone:pJC53.2; Vector Types:T/A Cloning Vector for dsRNA generation and the generation of sense and anti-sense probes; Bacterial Resistance:Ampicillin and Kanamycin
Defining Citation: PMID:23297191
Comments: Cloning primers: F-CCAGGCGTTCAAAGATTCTC, R-GATTTCCCGGTTCTCTTGGT
Proper citation: RRID:Addgene_99068 Copy
Species: Schmidtea mediterranea
Genetic Insert: LDLRR-1 in situ probe
Vector Backbone Description: Backbone Marker:Phillip Newmark (Addgene plasmid # 26536); Backbone Size:3240; Vector Backbone:pJC53.2; Vector Types:T/A Cloning Vector for dsRNA generation and the generation of sense and anti-sense probes; Bacterial Resistance:Ampicillin and Kanamycin
Defining Citation: PMID:27612384
Comments: Cloning primers: F-GCCTCACAATAGCACTTTCG R-GTAAATATTGATAATATATTTAAT
Note: There is a 1.3 kb deletion in the LDLRR-1 insert compared to KY024334.1. The depositor has confirmed this does not affect plasmid function.
Proper citation: RRID:Addgene_99093 Copy
Species: Schmidtea mediterranea
Genetic Insert: F-spondin in situ probe
Vector Backbone Description: Backbone Marker:Phillip Newmark (Addgene plasmid # 26536); Backbone Size:3240; Vector Backbone:pJC53.2; Vector Types:T/A Cloning Vector for dsRNA generation and the generation of sense and anti-sense probes; Bacterial Resistance:Ampicillin and Kanamycin
Defining Citation: PMID:27612384
Comments: Cloning primers: F-AAACAAAAGAGCATGGTTCA, R-AATCTTGCAAACATTCGAGA
Note: Only 143 base pairs from the insert align with KY024329.1. The depositor has confirmed this does not impact plasmid function.
Proper citation: RRID:Addgene_99096 Copy
Species: Schmidtea mediterranea
Genetic Insert: CNG1 in situ probe
Vector Backbone Description: Backbone Marker:Phillip Newmark (Addgene plasmid # 26536); Backbone Size:3240; Vector Backbone:pJC53.2; Vector Types:T/A Cloning Vector for dsRNA generation and the generation of sense and anti-sense probes; Bacterial Resistance:Ampicillin and Kanamycin
Defining Citation: PMID:27612384
Comments: Cloning primers: F-AATTGTCGAGCCCTTGGTAG, R-CCCAAATTTTTCGTTTAAAGGTT
Proper citation: RRID:Addgene_99098 Copy
Species: Schmidtea mediterranea
Genetic Insert: slc1a-5 (also known as excitatory amino acid transporter) in situ probe
Vector Backbone Description: Backbone Marker:Phillip Newmark (Addgene plasmid # 26536); Backbone Size:3240; Vector Backbone:pJC53.2; Vector Types:T/A Cloning Vector for dsRNA generation and the generation of sense and anti-sense probes; Bacterial Resistance:Ampicillin and Kanamycin
Defining Citation: PMID:27612384
Comments: Cloning primers: F-gtcaaatgggaaaggaagca R-attaattgtggcgcctatcg
Proper citation: RRID:Addgene_99102 Copy
Species: Schmidtea mediterranea
Genetic Insert: estrella in situ probe
Vector Backbone Description: Backbone Marker:Phillip Newmark (Addgene plasmid # 26536); Backbone Size:3240; Vector Backbone:pJC53.2; Vector Types:T/A Cloning Vector for dsRNA generation and the generation of sense and anti-sense probes; Bacterial Resistance:Ampicillin and Kanamycin
Defining Citation: PMID:27612384
Comments: Cloning primers: F-GAAGTCAATGGAACAGACGA, R-GAATTAGTGAGCGACCAGAA
Note: The estrella insert contains several mismatches compared to KY024338.1. The depositor has confirmed this does not affect plasmid function.
Proper citation: RRID:Addgene_99104 Copy
Species: Homo sapiens
Genetic Insert: hsa-let-7b-5p target
Vector Backbone Description: Vector Backbone:Low Sensor Backbone (LSB); Vector Types:Mammalian Expression, Synthetic Biology; Bacterial Resistance:Ampicillin and Kanamycin
Defining Citation: PMID:29934631
Comments: Please note that this plasmid is inherently unstable due to a repeating poly A element. We recommend performing a diagnostic digest on multiple colonies upon receipt. The depositors would like to note the presence of several discrepancies between the depositor sequence and physical plasmid sequence. In particular, the sequences upstream and downstream of the puromycin coding region have 10 bp insertions which do not affect the ability to perform puromycin selection. The sequences for those regions within the physical plasmids are as follows: Upstream of Puro: GAATTCGACCGCCTGTCTCAAGGTGCCACC; Downstream of Puro: GCTTTGAGACTACGCGTGAATTCACTCCTC.
Proper citation: RRID:Addgene_103148 Copy
Species: Streptomyces lavendulae subsp. lavendulae CCM 3239
Genetic Insert: T5 terminator
Vector Backbone Description: Backbone Size:4065; Vector Backbone:pBR322; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin and Kanamycin
Defining Citation: PMID:36173451
Proper citation: RRID:Addgene_190785 Copy
Species: pSA3239
Genetic Insert: upstream region of the aur1 cluster for auricin
Vector Backbone Description: Backbone Size:7907; Vector Backbone:sCos-1; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin and Kanamycin
Defining Citation: PMID:36173451
Proper citation: RRID:Addgene_190786 Copy
Species: Other
Genetic Insert: GFP
Vector Backbone Description: Backbone Marker:Enzynomics, Korea; Vector Backbone:pTOP-V2; Vector Types: tagging proteins in Cryptococcus neoforman; Bacterial Resistance:Ampicillin and Kanamycin
Defining Citation: PMID:27780958
Proper citation: RRID:Addgene_92081 Copy
Species: Other
Genetic Insert: GFP
Vector Backbone Description: Backbone Marker:Enzynomics, Korea; Vector Backbone:pTOP-V2; Vector Types: tagging proteins in Cryptococcus neoforman; Bacterial Resistance:Ampicillin and Kanamycin
Defining Citation: PMID:27780958
Proper citation: RRID:Addgene_92085 Copy
Species: Other
Genetic Insert: 4xFlag
Vector Backbone Description: Backbone Marker:Enzynomics, Korea; Vector Backbone:pTOP-V2; Vector Types: tagging proteins in Cryptococcus neoforman; Bacterial Resistance:Ampicillin and Kanamycin
Defining Citation: PMID:27780958
Proper citation: RRID:Addgene_92086 Copy
Species: Other
Genetic Insert: 6xHA
Vector Backbone Description: Backbone Marker:Enzynomics, Korea; Vector Backbone:pTOP-V2; Vector Types: tagging proteins in Cryptococcus neoforman; Bacterial Resistance:Ampicillin and Kanamycin
Defining Citation: PMID:27780958
Proper citation: RRID:Addgene_92083 Copy
Species: Other
Genetic Insert: mCherry
Vector Backbone Description: Backbone Marker:Enzynomics, Korea; Vector Backbone:pTOP-V2; Vector Types: tagging proteins in Cryptococcus neoforman; Bacterial Resistance:Ampicillin and Kanamycin
Defining Citation: PMID:27780958
Comments: Addgene's sequencing results found K128R and Q193P mutations in mCherry. These mutations are not known to affect plasmid function.
Proper citation: RRID:Addgene_92084 Copy
Species: Other
Genetic Insert: 4xFlag
Vector Backbone Description: Backbone Marker:Enzynomics, Korea; Vector Backbone:pTOP-V2; Vector Types: tagging proteins in Cryptococcus neoforman; Bacterial Resistance:Ampicillin and Kanamycin
Defining Citation: PMID:27780958
Proper citation: RRID:Addgene_92082 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within RRID that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
