Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
| Plasmid Name | Proper Citation | Insert Name | Organism | Bacterial Resistance | Defining Citation |
Comments |
||||
|---|---|---|---|---|---|---|---|---|---|---|
|
UQ4803 Resource Report Resource Website |
RRID:Addgene_37162 | rcoM1 in pEXT20 | Burkholderia xenovorans | Ampicillin | PMID:18326575 | This strain contains Roberts lab plasmid pUX2410 which is an pUX2396 derivative suitable for expression of Burkholderia xenovorans RcoM1 protein + C-terminal 6×His tag. Host strain is E. coli VJS6737. For strain usage see attached pdf. | Vector Backbone:pUX2410; Vector Types:; Bacterial Resistance:Ampicillin | 2026-08-15 01:14:13 | 0 | |
|
pDR125 Resource Report Resource Website 1+ mentions |
RRID:Addgene_37150 | lig4 | Homo sapiens | Ampicillin | Backbone Marker:Invitrogen; Backbone Size:4776; Vector Backbone:pFASTBAC1; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:14:13 | 2 | |||
|
pDR121 Resource Report Resource Website |
RRID:Addgene_37148 | XRCC6 | Homo sapiens | Ampicillin | Backbone Marker:Invitrogen; Backbone Size:4776; Vector Backbone:pFASTBAC1; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:14:13 | 0 | |||
|
pDR123 Resource Report Resource Website |
RRID:Addgene_37149 | XRCC5 | Homo sapiens | Ampicillin | Backbone Marker:Invitrogen; Backbone Size:4776; Vector Backbone:pFASTBAC1; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:14:13 | 0 | |||
|
pLK65 Resource Report Resource Website 1+ mentions |
RRID:Addgene_37257 | vang-like 2 | Homo sapiens | Ampicillin | PMID:16791850 | contains EGFP hVangl2 WT | Backbone Size:4224; Vector Backbone:pAdLox GI 1488684; Vector Types:Mammalian Expression, Adenoviral; Bacterial Resistance:Ampicillin | 2026-08-15 01:14:13 | 1 | |
|
pLK27 Resource Report Resource Website |
RRID:Addgene_37256 | Scribble | Homo sapiens | Ampicillin | PMID:16791850 | contains EGFP C-term | Backbone Size:4224; Vector Backbone:pAdLox GI 1488684; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | aa 1197-1630 | 2026-08-15 01:14:13 | 0 |
|
pLK01 Resource Report Resource Website |
RRID:Addgene_37252 | Scribble | Homo sapiens | Ampicillin | PMID:16791850 | contains EGFP-95-1630 hScrib | Backbone Size:4224; Vector Backbone:pAdLox GI 1488684; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | aa 95-1630 | 2026-08-15 01:14:13 | 0 |
|
pSR-puro-Mff1 shRNA Resource Report Resource Website 1+ mentions |
RRID:Addgene_37247 | Mff1 | Homo sapiens | Ampicillin | PMID:21822277 | Backbone Marker:OligoEngine; Backbone Size:6350; Vector Backbone:pSuper-Retro-Puro; Vector Types:Mammalian Expression, Retroviral, RNAi; Bacterial Resistance:Ampicillin | 2026-08-15 01:14:13 | 1 | ||
|
pGEX-5X2-hDrp1(518-736)-Flag Resource Report Resource Website |
RRID:Addgene_37244 | Drp1 | Homo sapiens | Ampicillin | PMID:21822277 | Addgene sequencing results show a V638F mutation in pGEX-Drp1. Please note that this is a polymorphism that does not affect function. | Backbone Marker:Amersham; Backbone Size:4973; Vector Backbone:pGEX-5X2; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | contains AA 517-end | 2026-08-15 01:14:13 | 0 |
|
pGEX-5X2-RalBP1 Resource Report Resource Website |
RRID:Addgene_37245 | RalBP1 | Homo sapiens | Ampicillin | PMID:21822277 | Backbone Marker:Amersham; Backbone Size:4973; Vector Backbone:pGEX-5X2; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:14:13 | 0 | ||
|
pAAV-Ef1a-DO_DIO-TdTomato_EGFP-WPRE-pA Resource Report Resource Website 10+ mentions |
RRID:Addgene_37120 | TdTomato-EGFP | Synthetic | Ampicillin | PMID:22866029 | Backbone Marker:K. Deisseroth Lab; Backbone Size:5627; Vector Backbone:pAAV-Ef1a-DIO-hChR2(H134R)-mCherry-WPRE-pA; Vector Types:AAV, Cre/Lox, Cre-Switch; Bacterial Resistance:Ampicillin | 2026-08-15 01:14:12 | 18 | ||
|
pAAV-Ef1a-DO-mCherry-WPRE-pA Resource Report Resource Website 1+ mentions |
RRID:Addgene_37119 | mCherry | Synthetic | Ampicillin | PMID:22866029 | Backbone Marker:K. Deisseroth Lab; Backbone Size:5613; Vector Backbone:pAAV-Ef1a-DIO-hChR2(H134R)-mCherry-WPRE-pA; Vector Types:AAV, Cre/Lox, Cre-Off; Bacterial Resistance:Ampicillin | 2026-08-15 01:14:12 | 3 | ||
|
pET His6 LIC cloning vector (2Bc-T) Resource Report Resource Website 1+ mentions |
RRID:Addgene_37236 | Ampicillin | This plasmid is an empty vector. Your gene can be inserted with a LIC cloning protocol. All 2-series vectors work as single-expression vectors, as well as transfer vectors for our polycistronic system. For more details, see the MacroLab vector cloning manual. The LIC cloning site is flanked by 5 pairs of restriction sites, so that your gene can easily be subcloned into our polycistronic destination vectors (2D, 2E, or 2Z). 2Bc-T has a TEV-cleavable C-terminal His6 tag to ease purification. To clone into this vector, add LIC v3 tags to the 5' end of your PCR primers. Forward - 5'TTTAAGAAGGAGATATAGTTC(ATG)3' Reverse - 5'GGATTGGAAGTAGAGGTTCTC3' Linearize the plasmid with HpaI and gel purify. When digesting the DNA with T4 polymerase, use dGTP for insert and dCTP for vector. More information on this vector can be found through http://qb3.berkeley.edu/qb3/macrolab/ | Backbone Size:4776; Vector Backbone:pET; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:14:13 | 5 | ||||
|
pTYB2-HCR1 Resource Report Resource Website |
RRID:Addgene_37233 | HRC1 | Saccharomyces cerevisiae | Ampicillin | PMID:20864040 | Backbone Marker:NEB; Backbone Size:7474; Vector Backbone:pTYB2; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:14:13 | 0 | ||
|
pQC NLS YFP IX Resource Report Resource Website 1+ mentions |
RRID:Addgene_37341 | NLS YFP | Synthetic | Ampicillin | PMID:21397594 | Backbone Marker:clontech; Backbone Size:6000; Vector Backbone:pQC; Vector Types:; Bacterial Resistance:Ampicillin | 2026-08-15 01:14:14 | 3 | ||
|
pQC membrane Venus IX Resource Report Resource Website 1+ mentions |
RRID:Addgene_37343 | membrane Venus | Synthetic | Ampicillin | PMID:21397594 | Backbone Marker:clontech; Backbone Size:6000; Vector Backbone:pQC; Vector Types:; Bacterial Resistance:Ampicillin | 2026-08-15 01:14:14 | 1 | ||
|
pQC NLS-CFP IX Resource Report Resource Website |
RRID:Addgene_37334 | NLS CFP | Synthetic | Ampicillin | PMID:21397594 | Backbone Marker:clontech; Backbone Size:6000; Vector Backbone:pQC; Vector Types:; Bacterial Resistance:Ampicillin | 2026-08-15 01:14:14 | 0 | ||
|
pQC membrane CFP IX Resource Report Resource Website |
RRID:Addgene_37336 | membrane CFP | Synthetic | Ampicillin | PMID:21397594 | Backbone Marker:clontech; Backbone Size:6000; Vector Backbone:pQC; Vector Types:; Bacterial Resistance:Ampicillin | 2026-08-15 01:14:14 | 0 | ||
|
pCaShs-hopscotch Resource Report Resource Website |
RRID:Addgene_37299 | hopscotch | Drosophila melanogaster | Ampicillin | PMID:7796812 | Perrimon Lab plasmid #99 | Backbone Size:8900; Vector Backbone:pCaSpeR-hs; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:14:14 | 0 | |
|
p45sheLL Resource Report Resource Website 1+ mentions |
RRID:Addgene_37323 | HPV45L1+L2 | Homo sapiens | Ampicillin | PMID:17603495 | Vector Backbone:custom; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:14:14 | 4 |
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
