Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
| Plasmid Name | Proper Citation | Insert Name | Organism | Bacterial Resistance | Defining Citation |
Comments |
||||
|---|---|---|---|---|---|---|---|---|---|---|
|
pRRG319-nlk Resource Report Resource Website |
RRID:Addgene_99082 | nemo-like kinase (also known as h.109.4e) in situ probe | Schmidtea mediterranea | Ampicillin and Kanamycin | PMID:23297191 | Cloning primers: F-CAAATGGTTGTTACGCTCCA R-GACATGGTCGACTGACAACG | Backbone Marker:Phillip Newmark (Addgene plasmid # 26536); Backbone Size:3240; Vector Backbone:pJC53.2; Vector Types:T/A Cloning Vector for dsRNA generation and the generation of sense and anti-sense probes; Bacterial Resistance:Ampicillin and Kanamycin | 2026-08-15 01:22:42 | 0 | |
|
pRRG325-Unc-9 Resource Report Resource Website |
RRID:Addgene_99084 | Unc-9 (also known as h.26.12f) in situ probe | Schmidtea mediterranea | Ampicillin and Kanamycin | PMID:23297191 | Cloning primers: F-TGTAGCTTTTTCCGGGAATTT, R-TACAATGCGTATTGCCGTTG | Backbone Marker:Phillip Newmark (Addgene plasmid # 26536); Backbone Size:3240; Vector Backbone:pJC53.2; Vector Types:T/A Cloning Vector for dsRNA generation and the generation of sense and anti-sense probes; Bacterial Resistance:Ampicillin and Kanamycin | 2026-08-15 01:22:42 | 0 | |
|
pRRG94-runt-1 Resource Report Resource Website |
RRID:Addgene_99089 | Runt-1 (also known as runt) in situ probe | Schmidtea mediterranea | Ampicillin and Kanamycin | PMID:27612384 | Cloning primers: F-AGTCGCAGTGGAAGAGGAAA, R-TGATGGGATTGCGAGTTGTA | Backbone Marker:Phillip Newmark (Addgene plasmid # 26536); Backbone Size:3240; Vector Backbone:pJC53.2; Vector Types:T/A Cloning Vector for dsRNA generation and the generation of sense and anti-sense probes; Bacterial Resistance:Ampicillin and Kanamycin | 2026-08-15 01:22:44 | 0 | |
|
pRRG203-notum Resource Report Resource Website |
RRID:Addgene_99067 | notum in situ probe | Schmidtea mediterranea | Ampicillin and Kanamycin | PMID:23297191 | Note: The notum insert contains several mismatches compared to JF725701.1. The depositor has confirmed this does not affect plasmid function. | Backbone Marker:Phillip Newmark (Addgene plasmid # 26536); Backbone Size:3240; Vector Backbone:pJC53.2; Vector Types:T/A Cloning Vector for dsRNA generation and the generation of sense and anti-sense probes; Bacterial Resistance:Ampicillin and Kanamycin | 2026-08-15 01:22:42 | 0 | |
|
pRRG36-ChAT Resource Report Resource Website |
RRID:Addgene_99069 | ChAT (choline acetyltransferase) in situ probe | Schmidtea mediterranea | Ampicillin and Kanamycin | PMID:23297191 | Cloning primers: F-GATCTCCTGCCACCAAAGAA, R-AACTCCATGACCCTGAATCG | Backbone Marker:Phillip Newmark (Addgene plasmid # 26536); Backbone Size:3240; Vector Backbone:pJC53.2; Vector Types:T/A Cloning Vector for dsRNA generation and the generation of sense and anti-sense probes; Bacterial Resistance:Ampicillin and Kanamycin | 2026-08-15 01:22:42 | 0 | |
|
pRRG159-foxD Resource Report Resource Website |
RRID:Addgene_99068 | foxD in situ probe | Schmidtea mediterranea | Ampicillin and Kanamycin | PMID:23297191 | Cloning primers: F-CCAGGCGTTCAAAGATTCTC, R-GATTTCCCGGTTCTCTTGGT | Backbone Marker:Phillip Newmark (Addgene plasmid # 26536); Backbone Size:3240; Vector Backbone:pJC53.2; Vector Types:T/A Cloning Vector for dsRNA generation and the generation of sense and anti-sense probes; Bacterial Resistance:Ampicillin and Kanamycin | 2026-08-15 01:22:44 | 0 | |
|
pRRG1013-LDLRR-1 Resource Report Resource Website |
RRID:Addgene_99093 | LDLRR-1 in situ probe | Schmidtea mediterranea | Ampicillin and Kanamycin | PMID:27612384 | Cloning primers: F-GCCTCACAATAGCACTTTCG R-GTAAATATTGATAATATATTTAAT Note: There is a 1.3 kb deletion in the LDLRR-1 insert compared to KY024334.1. The depositor has confirmed this does not affect plasmid function. | Backbone Marker:Phillip Newmark (Addgene plasmid # 26536); Backbone Size:3240; Vector Backbone:pJC53.2; Vector Types:T/A Cloning Vector for dsRNA generation and the generation of sense and anti-sense probes; Bacterial Resistance:Ampicillin and Kanamycin | 2026-08-15 01:22:43 | 0 | |
|
pRRG882-F-spondin Resource Report Resource Website |
RRID:Addgene_99096 | F-spondin in situ probe | Schmidtea mediterranea | Ampicillin and Kanamycin | PMID:27612384 | Cloning primers: F-AAACAAAAGAGCATGGTTCA, R-AATCTTGCAAACATTCGAGA Note: Only 143 base pairs from the insert align with KY024329.1. The depositor has confirmed this does not impact plasmid function. | Backbone Marker:Phillip Newmark (Addgene plasmid # 26536); Backbone Size:3240; Vector Backbone:pJC53.2; Vector Types:T/A Cloning Vector for dsRNA generation and the generation of sense and anti-sense probes; Bacterial Resistance:Ampicillin and Kanamycin | 2026-08-15 01:22:43 | 0 | |
|
pRRG377-CNG1 Resource Report Resource Website |
RRID:Addgene_99098 | CNG1 in situ probe | Schmidtea mediterranea | Ampicillin and Kanamycin | PMID:27612384 | Cloning primers: F-AATTGTCGAGCCCTTGGTAG, R-CCCAAATTTTTCGTTTAAAGGTT | Backbone Marker:Phillip Newmark (Addgene plasmid # 26536); Backbone Size:3240; Vector Backbone:pJC53.2; Vector Types:T/A Cloning Vector for dsRNA generation and the generation of sense and anti-sense probes; Bacterial Resistance:Ampicillin and Kanamycin | 2026-08-15 01:22:44 | 0 | |
|
pRRG312-slc1a-5 Resource Report Resource Website |
RRID:Addgene_99102 | slc1a-5 (also known as excitatory amino acid transporter) in situ probe | Schmidtea mediterranea | Ampicillin and Kanamycin | PMID:27612384 | Cloning primers: F-gtcaaatgggaaaggaagca R-attaattgtggcgcctatcg | Backbone Marker:Phillip Newmark (Addgene plasmid # 26536); Backbone Size:3240; Vector Backbone:pJC53.2; Vector Types:T/A Cloning Vector for dsRNA generation and the generation of sense and anti-sense probes; Bacterial Resistance:Ampicillin and Kanamycin | 2026-08-15 01:22:43 | 0 | |
|
pRRG820-estrella Resource Report Resource Website |
RRID:Addgene_99104 | estrella in situ probe | Schmidtea mediterranea | Ampicillin and Kanamycin | PMID:27612384 | Cloning primers: F-GAAGTCAATGGAACAGACGA, R-GAATTAGTGAGCGACCAGAA Note: The estrella insert contains several mismatches compared to KY024338.1. The depositor has confirmed this does not affect plasmid function. | Backbone Marker:Phillip Newmark (Addgene plasmid # 26536); Backbone Size:3240; Vector Backbone:pJC53.2; Vector Types:T/A Cloning Vector for dsRNA generation and the generation of sense and anti-sense probes; Bacterial Resistance:Ampicillin and Kanamycin | 2026-08-15 01:22:44 | 0 | |
|
LSB-hsa-let-7b-5p Resource Report Resource Website |
RRID:Addgene_103148 | hsa-let-7b-5p target | Homo sapiens | Ampicillin and Kanamycin | PMID:29934631 | Please note that this plasmid is inherently unstable due to a repeating poly A element. We recommend performing a diagnostic digest on multiple colonies upon receipt. The depositors would like to note the presence of several discrepancies between the depositor sequence and physical plasmid sequence. In particular, the sequences upstream and downstream of the puromycin coding region have 10 bp insertions which do not affect the ability to perform puromycin selection. The sequences for those regions within the physical plasmids are as follows: Upstream of Puro: GAATTCGACCGCCTGTCTCAAGGTGCCACC; Downstream of Puro: GCTTTGAGACTACGCGTGAATTCACTCCTC. | Vector Backbone:Low Sensor Backbone (LSB); Vector Types:Mammalian Expression, Synthetic Biology; Bacterial Resistance:Ampicillin and Kanamycin | 2026-08-15 01:23:11 | 0 | |
|
pPhiC31-actIIORF4 Resource Report Resource Website |
RRID:Addgene_190785 | T5 terminator | Streptomyces lavendulae subsp. lavendulae CCM 3239 | Ampicillin and Kanamycin | PMID:36173451 | Backbone Size:4065; Vector Backbone:pBR322; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin and Kanamycin | 2026-08-15 01:24:06 | 0 | ||
|
pCosSAD1AprR Resource Report Resource Website |
RRID:Addgene_190786 | upstream region of the aur1 cluster for auricin | pSA3239 | Ampicillin and Kanamycin | PMID:36173451 | Backbone Size:7907; Vector Backbone:sCos-1; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin and Kanamycin | 2026-08-15 01:24:06 | 0 | ||
|
YSBE 508 : pNEO_GFP Resource Report Resource Website |
RRID:Addgene_92081 | GFP | Other | Ampicillin and Kanamycin | PMID:27780958 | Backbone Marker:Enzynomics, Korea; Vector Backbone:pTOP-V2; Vector Types: tagging proteins in Cryptococcus neoforman; Bacterial Resistance:Ampicillin and Kanamycin | 2026-08-15 01:22:27 | 0 | ||
|
YSBE 557 : pNAT_GFP Resource Report Resource Website |
RRID:Addgene_92085 | GFP | Other | Ampicillin and Kanamycin | PMID:27780958 | Backbone Marker:Enzynomics, Korea; Vector Backbone:pTOP-V2; Vector Types: tagging proteins in Cryptococcus neoforman; Bacterial Resistance:Ampicillin and Kanamycin | 2026-08-15 01:22:27 | 0 | ||
|
YSBE 558 : pNAT_4xFLAG Resource Report Resource Website |
RRID:Addgene_92086 | 4xFlag | Other | Ampicillin and Kanamycin | PMID:27780958 | Backbone Marker:Enzynomics, Korea; Vector Backbone:pTOP-V2; Vector Types: tagging proteins in Cryptococcus neoforman; Bacterial Resistance:Ampicillin and Kanamycin | 2026-08-15 01:22:27 | 0 | ||
|
YSBE 517 : pNEO_6xHA Resource Report Resource Website |
RRID:Addgene_92083 | 6xHA | Other | Ampicillin and Kanamycin | PMID:27780958 | Backbone Marker:Enzynomics, Korea; Vector Backbone:pTOP-V2; Vector Types: tagging proteins in Cryptococcus neoforman; Bacterial Resistance:Ampicillin and Kanamycin | 2026-08-15 01:22:27 | 0 | ||
|
YSBE 524 : pNEO_mCherry Resource Report Resource Website |
RRID:Addgene_92084 | mCherry | Other | Ampicillin and Kanamycin | PMID:27780958 | Addgene's sequencing results found K128R and Q193P mutations in mCherry. These mutations are not known to affect plasmid function. | Backbone Marker:Enzynomics, Korea; Vector Backbone:pTOP-V2; Vector Types: tagging proteins in Cryptococcus neoforman; Bacterial Resistance:Ampicillin and Kanamycin | 2026-08-15 01:22:27 | 0 | |
|
YSBE 516 : pNEO_4xFLAG Resource Report Resource Website |
RRID:Addgene_92082 | 4xFlag | Other | Ampicillin and Kanamycin | PMID:27780958 | Backbone Marker:Enzynomics, Korea; Vector Backbone:pTOP-V2; Vector Types: tagging proteins in Cryptococcus neoforman; Bacterial Resistance:Ampicillin and Kanamycin | 2026-08-15 01:22:27 | 0 |
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
