Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
| Plasmid Name | Proper Citation | Insert Name | Organism | Bacterial Resistance | Defining Citation |
Comments |
||||
|---|---|---|---|---|---|---|---|---|---|---|
|
pLG-deltaA Resource Report Resource Website |
RRID:Addgene_33151 | RP51A-synthetic minimal intron | Saccharomyces cerevisiae | Ampicillin | PMID:2655924 | Original intron sequence: GTATGTTAATATGGTTAACGTCGACCGTGTTTTTGATATCTATACTAACAGGCCTTTTAATAG Modified intron sequence: GACCGTGTTTTTGATATCTATACTAACAGGCCTTTTAATAG | Vector Backbone:pLGSD5; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin | The RP51A sequence was modified by digestion with StyI and HincII, filled in and ligated to delete ~27bp including the 5' splice site | 2026-08-15 01:13:47 | 0 |
|
P413TEF-PYK1 Resource Report Resource Website |
RRID:Addgene_34605 | PYK1 | Saccharomyces cerevisiae | Ampicillin | PMID:21907146 | Backbone Marker:ATCC#87362 (PMID:7737504); Backbone Size:5557; Vector Backbone:P413TEF; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:13:53 | 0 | ||
|
p416GPD-PYK1 Resource Report Resource Website |
RRID:Addgene_34604 | PYK1 | Saccharomyces cerevisiae | Ampicillin | PMID:21907146 | Backbone Marker:ATCC#87360 (PMID: 7737504; Backbone Size:5739; Vector Backbone:p416GPD; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:14:01 | 0 | ||
|
pTSK241 Resource Report Resource Website |
RRID:Addgene_34550 | Ace1 | Saccharomyces cerevisiae | Ampicillin | PMID:18218898 | Backbone Marker:T.S Karpova; Vector Backbone:pTSK65; Vector Types:Yeast Expression, Integrative Plasmid; Bacterial Resistance:Ampicillin | 2026-08-15 01:13:53 | 0 | ||
|
pDS248 Resource Report Resource Website |
RRID:Addgene_34968 | Mid2(SS/TM)-GFP-LOVpep | Saccharomyces cerevisiae | Ampicillin | PMID:22388287 | The LOV2 domain is amino acids 404-540 and differs from the wild-type A. sativa LOV2 sequence by the point mutations G528A and N534E. See Strickland et al. for details. | Backbone Size:4263; Vector Backbone:YIPlac128; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin | T406A, T407A, V416I | 2026-08-15 01:13:56 | 0 |
|
pDS221 Resource Report Resource Website 1+ mentions |
RRID:Addgene_34981 | ePDZb1–mCherry | Saccharomyces cerevisiae | Ampicillin | PMID:22388287 | Vector Backbone:YIPlac211; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:13:56 | 4 | ||
|
pDS220 Resource Report Resource Website 1+ mentions |
RRID:Addgene_34980 | ePDZb–mCherry | Saccharomyces cerevisiae | Ampicillin | PMID:22388287 | Vector Backbone:YIPlac211; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:14:03 | 1 | ||
|
pDS295 Resource Report Resource Website |
RRID:Addgene_34984 | ePDZb | Saccharomyces cerevisiae | Ampicillin | PMID:22388287 | Vector Backbone:YIPlac211; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:13:56 | 0 | ||
|
pDS257 Resource Report Resource Website 1+ mentions |
RRID:Addgene_34971 | Mid2(SS/TM)-GFP-LOVpep | Saccharomyces cerevisiae | Ampicillin | PMID:22388287 | The LOV2 domain is amino acids 404-540 and differs from the wild-type A. sativa LOV2 sequence by the point mutations G528A and N534E. See Strickland et al. for details. | Backbone Size:4263; Vector Backbone:YIPlac128; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:13:56 | 1 | |
|
pDS255 Resource Report Resource Website |
RRID:Addgene_34970 | Mid2(SS/TM)-GFP-LOVpep | Saccharomyces cerevisiae | Ampicillin | PMID:22388287 | The LOV2 domain is amino acids 404-540 and differs from the wild-type A. sativa LOV2 sequence by the point mutations G528A and N534E. See Strickland et al. for details. | Backbone Size:4263; Vector Backbone:YIPlac128; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin | T406A, T407A | 2026-08-15 01:13:56 | 0 |
|
pDS191 Resource Report Resource Website |
RRID:Addgene_34978 | ePDZb | Saccharomyces cerevisiae | Ampicillin | PMID:22388287 | Backbone Marker:EUROSCARF; Backbone Size:6624; Vector Backbone:pGREG503; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:13:56 | 0 | ||
|
pBbA5c-MevT(CO)-T1-MBIS(CO, ispA) Resource Report Resource Website 1+ mentions |
RRID:Addgene_35152 | AtoB(co)-HMGS(co)-HMGR(co)-pTrc-MK(co)-PMK(co)-PMD-Idi-IspA | Saccharomyces cerevisiae | Chloramphenicol | PMID:21952217 | Please note that the R364 in Mevalonate Kinase (MK) may be susceptible to mutations. Although the original plasmid encoded R364C, Addgene's stock contains R364S. This mutation is not expected to impact overall function, however the exact effects are unknown. | Vector Backbone:pBbA5c; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Chloramphenicol | R364S in Mevalonate Kinase | 2026-08-15 01:13:58 | 3 |
|
pSA48 Resource Report Resource Website |
RRID:Addgene_35112 | lys5MX3 | Saccharomyces cerevisiae | Ampicillin | PMID:14745782 | Vector Backbone:pFA6-kanMX4; Vector Types:Yeast Replicating; Bacterial Resistance:Ampicillin | 2026-08-15 01:13:57 | 0 | ||
|
pSA25 Resource Report Resource Website |
RRID:Addgene_35116 | lys5MX4 | Saccharomyces cerevisiae | Ampicillin | PMID:14745782 | Vector Backbone:pRS316; Vector Types:Yeast replicating; Bacterial Resistance:Ampicillin | 2026-08-15 01:14:04 | 0 | ||
|
pBN63 Resource Report Resource Website 1+ mentions |
RRID:Addgene_35104 | fcy1PR | Saccharomyces cerevisiae | Ampicillin | PMID:16088873 | Vector Backbone:pFA6-kanMX3; Vector Types:Yeast replicating; Bacterial Resistance:Ampicillin | 2026-08-15 01:13:57 | 1 | ||
|
pPH37 Resource Report Resource Website 1+ mentions |
RRID:Addgene_35102 | fcy1MX4 | Saccharomyces cerevisiae | Ampicillin | PMID:16088873 | Vector Backbone:pFA6-kanMX4; Vector Types:Yeast replicating; Bacterial Resistance:Ampicillin | 2026-08-15 01:13:57 | 2 | ||
|
pDZ207 (loxP KAN loxP 24xPP7SL MDN1) Resource Report Resource Website |
RRID:Addgene_35191 | loxP KAN loxP 24xPP7SL MDN1 | Saccharomyces cerevisiae | Ampicillin | PMID:21512033 | This plasmid was designed to construct mRNAs that contain multiple copies of an RNA sequence (the 24xPP7 stem-loops) that can be recognized by a chimeric RNA-binding protein fused to GFP, encoded in plasmid pDZ276 (Addgene plasmid #35194). See associated publication for detailed methods and use of this plasmid. Please note that the LacZa-ccdB fusion in this plasmid is not functional and was originally present in the vector backbone to aid in screening for insert. Addgene's sequencing results identified a 3 nucleotide deletion at bp# 543-545 when compared to the full plasmid sequence provided by the depositing laboratory. This deletion is not known to affect plasmid function. | Backbone Marker:Invitrogen; Backbone Size:3956; Vector Backbone:pCR4; Vector Types:Bacterial Expression, Cre/Lox; Bacterial Resistance:Ampicillin | 2026-08-15 01:13:58 | 0 | |
|
Sgf73(1-106)/PET32a Resource Report Resource Website |
RRID:Addgene_26962 | Sgf73(1-106) | Saccharomyces cerevisiae | Ampicillin | PMID:20395473 | Backbone Size:5900; Vector Backbone:PET32a; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | with TEV site to cleave the N-terminal his+Trx tag | 2026-08-15 01:12:58 | 0 | |
|
Sus1/PRSF Resource Report Resource Website 1+ mentions |
RRID:Addgene_26961 | Sus1 | Saccharomyces cerevisiae | Kanamycin | PMID:20395473 | Backbone Size:3669; Vector Backbone:PRSF; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin | 2026-08-15 01:12:58 | 1 | ||
|
Sgf73_Sgf11/PCDFDuet Resource Report Resource Website 1+ mentions |
RRID:Addgene_26964 | sgf11 | Saccharomyces cerevisiae | Spectinomycin and Streptomycin | PMID:20395473 | sgf 73(1-96) cloned in the second frame by NdeI+BglII for coexpression | Backbone Marker:Novagen; Backbone Size:3781; Vector Backbone:pCDFDuet; Vector Types:Bacterial Expression; Bacterial Resistance:Spectinomycin and Streptomycin | 2026-08-15 01:12:58 | 1 |
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.