Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Preparing word cloud

×

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search

Filter by records added date
See new records

Options


Current Facets and Filters

  • Organism:saccharomyces cerevisiae (facet)


Recent searches

Snippet view Table view
Click the to add this resource to a Collection

4,486 Results - per page

Show More Columns | Download Top 1000 Results

Plasmid Name Proper Citation Insert Name Organism Bacterial Resistance Defining Citation Comments Vector Backbone Description Relevant Mutation Record Last Update Mentions Count
pLG-deltaA
 
Resource Report
Resource Website
RRID:Addgene_33151 RP51A-synthetic minimal intron Saccharomyces cerevisiae Ampicillin PMID:2655924 Original intron sequence: GTATGTTAATATGGTTAACGTCGACCGTGTTTTTGATATCTATACTAACAGGCCTTTTAATAG Modified intron sequence: GACCGTGTTTTTGATATCTATACTAACAGGCCTTTTAATAG Vector Backbone:pLGSD5; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin The RP51A sequence was modified by digestion with StyI and HincII, filled in and ligated to delete ~27bp including the 5' splice site 2026-08-15 01:13:47 0
P413TEF-PYK1
 
Resource Report
Resource Website
RRID:Addgene_34605 PYK1 Saccharomyces cerevisiae Ampicillin PMID:21907146 Backbone Marker:ATCC#87362 (PMID:7737504); Backbone Size:5557; Vector Backbone:P413TEF; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:13:53 0
p416GPD-PYK1
 
Resource Report
Resource Website
RRID:Addgene_34604 PYK1 Saccharomyces cerevisiae Ampicillin PMID:21907146 Backbone Marker:ATCC#87360 (PMID: 7737504; Backbone Size:5739; Vector Backbone:p416GPD; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:14:01 0
pTSK241
 
Resource Report
Resource Website
RRID:Addgene_34550 Ace1 Saccharomyces cerevisiae Ampicillin PMID:18218898 Backbone Marker:T.S Karpova; Vector Backbone:pTSK65; Vector Types:Yeast Expression, Integrative Plasmid; Bacterial Resistance:Ampicillin 2026-08-15 01:13:53 0
pDS248
 
Resource Report
Resource Website
RRID:Addgene_34968 Mid2(SS/TM)-GFP-LOVpep Saccharomyces cerevisiae Ampicillin PMID:22388287 The LOV2 domain is amino acids 404-540 and differs from the wild-type A. sativa LOV2 sequence by the point mutations G528A and N534E. See Strickland et al. for details. Backbone Size:4263; Vector Backbone:YIPlac128; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin T406A, T407A, V416I 2026-08-15 01:13:56 0
pDS221
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_34981 ePDZb1–mCherry Saccharomyces cerevisiae Ampicillin PMID:22388287 Vector Backbone:YIPlac211; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:13:56 4
pDS220
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_34980 ePDZb–mCherry Saccharomyces cerevisiae Ampicillin PMID:22388287 Vector Backbone:YIPlac211; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:14:03 1
pDS295
 
Resource Report
Resource Website
RRID:Addgene_34984 ePDZb Saccharomyces cerevisiae Ampicillin PMID:22388287 Vector Backbone:YIPlac211; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:13:56 0
pDS257
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_34971 Mid2(SS/TM)-GFP-LOVpep Saccharomyces cerevisiae Ampicillin PMID:22388287 The LOV2 domain is amino acids 404-540 and differs from the wild-type A. sativa LOV2 sequence by the point mutations G528A and N534E. See Strickland et al. for details. Backbone Size:4263; Vector Backbone:YIPlac128; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:13:56 1
pDS255
 
Resource Report
Resource Website
RRID:Addgene_34970 Mid2(SS/TM)-GFP-LOVpep Saccharomyces cerevisiae Ampicillin PMID:22388287 The LOV2 domain is amino acids 404-540 and differs from the wild-type A. sativa LOV2 sequence by the point mutations G528A and N534E. See Strickland et al. for details. Backbone Size:4263; Vector Backbone:YIPlac128; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin T406A, T407A 2026-08-15 01:13:56 0
pDS191
 
Resource Report
Resource Website
RRID:Addgene_34978 ePDZb Saccharomyces cerevisiae Ampicillin PMID:22388287 Backbone Marker:EUROSCARF; Backbone Size:6624; Vector Backbone:pGREG503; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:13:56 0
pBbA5c-MevT(CO)-T1-MBIS(CO, ispA)
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_35152 AtoB(co)-HMGS(co)-HMGR(co)-pTrc-MK(co)-PMK(co)-PMD-Idi-IspA Saccharomyces cerevisiae Chloramphenicol PMID:21952217 Please note that the R364 in Mevalonate Kinase (MK) may be susceptible to mutations. Although the original plasmid encoded R364C, Addgene's stock contains R364S. This mutation is not expected to impact overall function, however the exact effects are unknown. Vector Backbone:pBbA5c; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Chloramphenicol R364S in Mevalonate Kinase 2026-08-15 01:13:58 3
pSA48
 
Resource Report
Resource Website
RRID:Addgene_35112 lys5MX3 Saccharomyces cerevisiae Ampicillin PMID:14745782 Vector Backbone:pFA6-kanMX4; Vector Types:Yeast Replicating; Bacterial Resistance:Ampicillin 2026-08-15 01:13:57 0
pSA25
 
Resource Report
Resource Website
RRID:Addgene_35116 lys5MX4 Saccharomyces cerevisiae Ampicillin PMID:14745782 Vector Backbone:pRS316; Vector Types:Yeast replicating; Bacterial Resistance:Ampicillin 2026-08-15 01:14:04 0
pBN63
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_35104 fcy1PR Saccharomyces cerevisiae Ampicillin PMID:16088873 Vector Backbone:pFA6-kanMX3; Vector Types:Yeast replicating; Bacterial Resistance:Ampicillin 2026-08-15 01:13:57 1
pPH37
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_35102 fcy1MX4 Saccharomyces cerevisiae Ampicillin PMID:16088873 Vector Backbone:pFA6-kanMX4; Vector Types:Yeast replicating; Bacterial Resistance:Ampicillin 2026-08-15 01:13:57 2
pDZ207 (loxP KAN loxP 24xPP7SL MDN1)
 
Resource Report
Resource Website
RRID:Addgene_35191 loxP KAN loxP 24xPP7SL MDN1 Saccharomyces cerevisiae Ampicillin PMID:21512033 This plasmid was designed to construct mRNAs that contain multiple copies of an RNA sequence (the 24xPP7 stem-loops) that can be recognized by a chimeric RNA-binding protein fused to GFP, encoded in plasmid pDZ276 (Addgene plasmid #35194). See associated publication for detailed methods and use of this plasmid. Please note that the LacZa-ccdB fusion in this plasmid is not functional and was originally present in the vector backbone to aid in screening for insert. Addgene's sequencing results identified a 3 nucleotide deletion at bp# 543-545 when compared to the full plasmid sequence provided by the depositing laboratory. This deletion is not known to affect plasmid function. Backbone Marker:Invitrogen; Backbone Size:3956; Vector Backbone:pCR4; Vector Types:Bacterial Expression, Cre/Lox; Bacterial Resistance:Ampicillin 2026-08-15 01:13:58 0
Sgf73(1-106)/PET32a
 
Resource Report
Resource Website
RRID:Addgene_26962 Sgf73(1-106) Saccharomyces cerevisiae Ampicillin PMID:20395473 Backbone Size:5900; Vector Backbone:PET32a; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin with TEV site to cleave the N-terminal his+Trx tag 2026-08-15 01:12:58 0
Sus1/PRSF
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_26961 Sus1 Saccharomyces cerevisiae Kanamycin PMID:20395473 Backbone Size:3669; Vector Backbone:PRSF; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin 2026-08-15 01:12:58 1
Sgf73_Sgf11/PCDFDuet
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_26964 sgf11 Saccharomyces cerevisiae Spectinomycin and Streptomycin PMID:20395473 sgf 73(1-96) cloned in the second frame by NdeI+BglII for coexpression Backbone Marker:Novagen; Backbone Size:3781; Vector Backbone:pCDFDuet; Vector Types:Bacterial Expression; Bacterial Resistance:Spectinomycin and Streptomycin 2026-08-15 01:12:58 1

Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
X
  1. RRID Portal Resources

    Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Collections

    If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  6. Facets

    Here are the facets that you can filter the data by.

  7. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.