Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Saccharomyces cerevisiae
Genetic Insert: RP51A-synthetic minimal intron
Vector Backbone Description: Vector Backbone:pLGSD5; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:2655924
Comments: Original intron sequence: GTATGTTAATATGGTTAACGTCGACCGTGTTTTTGATATCTATACTAACAGGCCTTTTAATAG
Modified intron sequence: GACCGTGTTTTTGATATCTATACTAACAGGCCTTTTAATAG
Proper citation: RRID:Addgene_33151 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: PYK1
Vector Backbone Description: Backbone Marker:ATCC#87362 (PMID:7737504); Backbone Size:5557; Vector Backbone:P413TEF; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21907146
Proper citation: RRID:Addgene_34605 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: PYK1
Vector Backbone Description: Backbone Marker:ATCC#87360 (PMID: 7737504; Backbone Size:5739; Vector Backbone:p416GPD; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21907146
Proper citation: RRID:Addgene_34604 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: Ace1
Vector Backbone Description: Backbone Marker:T.S Karpova; Vector Backbone:pTSK65; Vector Types:Yeast Expression, Integrative Plasmid; Bacterial Resistance:Ampicillin
Defining Citation: PMID:18218898
Proper citation: RRID:Addgene_34550 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: Mid2(SS/TM)-GFP-LOVpep
Vector Backbone Description: Backbone Size:4263; Vector Backbone:YIPlac128; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22388287
Comments: The LOV2 domain is amino acids 404-540 and differs from the wild-type A. sativa LOV2 sequence by the point mutations G528A and N534E. See Strickland et al. for details.
Proper citation: RRID:Addgene_34968 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: ePDZb1–mCherry
Vector Backbone Description: Vector Backbone:YIPlac211; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22388287
Proper citation: RRID:Addgene_34981 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: ePDZb–mCherry
Vector Backbone Description: Vector Backbone:YIPlac211; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22388287
Proper citation: RRID:Addgene_34980 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: ePDZb
Vector Backbone Description: Vector Backbone:YIPlac211; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22388287
Proper citation: RRID:Addgene_34984 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: Mid2(SS/TM)-GFP-LOVpep
Vector Backbone Description: Backbone Size:4263; Vector Backbone:YIPlac128; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22388287
Comments: The LOV2 domain is amino acids 404-540 and differs from the wild-type A. sativa LOV2 sequence by the point mutations G528A and N534E. See Strickland et al. for details.
Proper citation: RRID:Addgene_34971 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: Mid2(SS/TM)-GFP-LOVpep
Vector Backbone Description: Backbone Size:4263; Vector Backbone:YIPlac128; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22388287
Comments: The LOV2 domain is amino acids 404-540 and differs from the wild-type A. sativa LOV2 sequence by the point mutations G528A and N534E. See Strickland et al. for details.
Proper citation: RRID:Addgene_34970 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: ePDZb
Vector Backbone Description: Backbone Marker:EUROSCARF; Backbone Size:6624; Vector Backbone:pGREG503; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22388287
Proper citation: RRID:Addgene_34978 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: AtoB(co)-HMGS(co)-HMGR(co)-pTrc-MK(co)-PMK(co)-PMD-Idi-IspA
Vector Backbone Description: Vector Backbone:pBbA5c; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Chloramphenicol
Defining Citation: PMID:21952217
Comments: Please note that the R364 in Mevalonate Kinase (MK) may be susceptible to mutations. Although the original plasmid encoded R364C, Addgene's stock contains R364S. This mutation is not expected to impact overall function, however the exact effects are unknown.
Proper citation: RRID:Addgene_35152 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: lys5MX3
Vector Backbone Description: Vector Backbone:pFA6-kanMX4; Vector Types:Yeast Replicating; Bacterial Resistance:Ampicillin
Defining Citation: PMID:14745782
Proper citation: RRID:Addgene_35112 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: lys5MX4
Vector Backbone Description: Vector Backbone:pRS316; Vector Types:Yeast replicating; Bacterial Resistance:Ampicillin
Defining Citation: PMID:14745782
Proper citation: RRID:Addgene_35116 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: fcy1PR
Vector Backbone Description: Vector Backbone:pFA6-kanMX3; Vector Types:Yeast replicating; Bacterial Resistance:Ampicillin
Defining Citation: PMID:16088873
Proper citation: RRID:Addgene_35104 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: fcy1MX4
Vector Backbone Description: Vector Backbone:pFA6-kanMX4; Vector Types:Yeast replicating; Bacterial Resistance:Ampicillin
Defining Citation: PMID:16088873
Proper citation: RRID:Addgene_35102 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: loxP KAN loxP 24xPP7SL MDN1
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:3956; Vector Backbone:pCR4; Vector Types:Bacterial Expression, Cre/Lox; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21512033
Comments: This plasmid was designed to construct mRNAs that contain multiple copies of an RNA sequence (the 24xPP7 stem-loops) that can be recognized by a chimeric RNA-binding protein fused to GFP, encoded in plasmid pDZ276 (Addgene plasmid #35194). See associated publication for detailed methods and use of this plasmid.
Please note that the LacZa-ccdB fusion in this plasmid is not functional and was originally present in the vector backbone to aid in screening for insert.
Addgene's sequencing results identified a 3 nucleotide deletion at bp# 543-545 when compared to the full plasmid sequence provided by the depositing laboratory. This deletion is not known to affect plasmid function.
Proper citation: RRID:Addgene_35191 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: Sgf73(1-106)
Vector Backbone Description: Backbone Size:5900; Vector Backbone:PET32a; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:20395473
Proper citation: RRID:Addgene_26962 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: Sus1
Vector Backbone Description: Backbone Size:3669; Vector Backbone:PRSF; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:20395473
Proper citation: RRID:Addgene_26961 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: sgf11
Vector Backbone Description: Backbone Marker:Novagen; Backbone Size:3781; Vector Backbone:pCDFDuet; Vector Types:Bacterial Expression; Bacterial Resistance:Spectinomycin and Streptomycin
Defining Citation: PMID:20395473
Comments: sgf 73(1-96) cloned in the second frame by NdeI+BglII for coexpression
Proper citation: RRID:Addgene_26964 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within RRID that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.