Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
| Plasmid Name | Proper Citation | Insert Name | Organism | Bacterial Resistance | Defining Citation |
Comments |
||||
|---|---|---|---|---|---|---|---|---|---|---|
|
pABpuro-BluF Resource Report Resource Website 10+ mentions |
RRID:Addgene_46824 | Bmal1 | Mus musculus | Ampicillin | PMID:16167846 | The insert consists of 1 kb of mouse Bmal1 upstream region and 53 nucleotides of exon 1, fused in-frame to the luciferase coding region, and followed by 1 kb of Bmal1 3′UTR. | Backbone Marker:Addgene plasmid 12254; Vector Backbone:pWPI; Vector Types:Mammalian Expression, Lentiviral, Luciferase; Bacterial Resistance:Ampicillin | 2026-08-15 01:15:35 | 17 | |
|
psd44-G13WT Resource Report Resource Website 1+ mentions |
RRID:Addgene_46829 | GNA13 | Homo sapiens | Ampicillin | cDNA to make this plasmid was obtained from www.cdna.org (ID GNA1300000). | Backbone Marker:Dr. Richard Iggo, University of St Andrews, Edinburgh, UK; Backbone Size:9195; Vector Backbone:psd44; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin | 2026-08-15 01:15:36 | 2 | ||
|
PCMV-intron myc Rab11 S25N Resource Report Resource Website 1+ mentions |
RRID:Addgene_46786 | RAB11A S25N | Homo sapiens | Ampicillin | PMID:16959776 | cDNA was obtained from UMR cDNA Resource Center, www.cdna.org To make mutation, the following primers were used for PCR amplification: Rab11 S25N FWD (5′-AGCTCGGATCCACCATGGGCACCCGCGACGACGAGT ACGACTACCTCTTTAAAGTTGTCCTTATTGGAGATTCTGGTGTTGGAAAGAATAATCTCCTGTCT-3′) BGH RVS primer (5′-TAGAAGGCACAGTCGAGG-3′) | Vector Backbone:pCMV-intron myc; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | S25N dominant negative | 2026-08-15 01:15:35 | 2 |
|
Rab8WT(Flag) in pcDNA3.1neo Resource Report Resource Website 1+ mentions |
RRID:Addgene_46783 | RAB8A | Homo sapiens | Ampicillin | PMID:16959776 | Also see Dupré et al., 2006 Cell Signal. 2007 Mar;19(3):481-9. https://www.ncbi.nlm.nih.gov/pubmed/16979872 for more information. | Backbone Marker:invitrogen; Backbone Size:5400; Vector Backbone:pcDNA3.1neo; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:15:35 | 2 | |
|
pCEV-G1-Ph Resource Report Resource Website 1+ mentions |
RRID:Addgene_46814 | Ampicillin | PMID:24161108 | Vector Backbone:pSP-G1; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:15:36 | 3 | ||||
|
pCEV-G4-Km Resource Report Resource Website 1+ mentions |
RRID:Addgene_46819 | Ampicillin | PMID:24161108 | Vector Backbone:pCEV-G2-Km; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:15:35 | 4 | ||||
|
BDD FVIII H4 Resource Report Resource Website |
RRID:Addgene_46774 | B-domain deleted FVIII H4 (R484H) | Homo sapiens | Ampicillin | Polymorphisms described in: Inhibitors of factor VIII in black patients with hemophilia. Viel KR, Ameri A, Abshire TC, Iyer RV, Watts RG, Lutcher C, Channell C, Cole SA, Fernstrom KM, Nakaya S, Kasper CK, Thompson AR, Almasy L, Howard TE. N Engl J Med. 2009 Apr 16;360(16):1618-27. doi: 10.1056/NEJMoa075760. Erratum in: N Engl J Med. 2009 Jul 30;361(5):544. PMID:1936966 | Backbone Marker:Invitrogen; Backbone Size:5000; Vector Backbone:pcDNA4; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | R484H | 2026-08-15 01:15:35 | 0 | |
|
FVIII H2 Resource Report Resource Website |
RRID:Addgene_46773 | full length FVIII D1241E | Homo sapiens | Ampicillin | Polymorphisms described in: Inhibitors of factor VIII in black patients with hemophilia. Viel KR, Ameri A, Abshire TC, Iyer RV, Watts RG, Lutcher C, Channell C, Cole SA, Fernstrom KM, Nakaya S, Kasper CK, Thompson AR, Almasy L, Howard TE. N Engl J Med. 2009 Apr 16;360(16):1618-27. doi: 10.1056/NEJMoa075760. Erratum in: N Engl J Med. 2009 Jul 30;361(5):544. PMID:1936966 | Backbone Marker:Invitrogen; Backbone Size:5000; Vector Backbone:pcDNA4; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | D1241E | 2026-08-15 01:15:35 | 0 | |
|
PCMV-intron myc Rab1aWT Resource Report Resource Website 1+ mentions |
RRID:Addgene_46776 | Rab1a | Homo sapiens | Ampicillin | PMID:16959776 | cDNA was obtained from UMR cDNA Resource Center, www.cdna.org . Also see Dupré et al., 2006 Cell Signal. 2007 Mar;19(3):481-9. https://www.ncbi.nlm.nih.gov/pubmed/16979872 for more information. | Vector Backbone:pCMV-intron myc; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:15:35 | 4 | |
|
PCMV-intron myc Rab1a S25N Resource Report Resource Website 1+ mentions |
RRID:Addgene_46777 | Rab1a S25N mutant | Homo sapiens | Ampicillin | PMID:16959776 | cDNA was obtained from UMR cDNA Resource Center, www.cdna.org To make mutation, the following primers were used for PCR amplification: Rab1 S25N FWD (5′-AGCTCGGATCCACCATGTCCAGCATGAATCCCGAATATGATTATTTATTCAAGTTACTTCTGATTGGCGACTCAGGGGTTGGAAAGAATTGCCTTCTTCT-3′) BGH RVS primer (5′-TAGAAGGCACAGTCGAGG-3′) | Vector Backbone:pCMV-intron myc; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | S25N (dominant negative) | 2026-08-15 01:15:35 | 2 |
|
pcDNAI-GAL4-CREB-S133A Resource Report Resource Website 1+ mentions |
RRID:Addgene_46770 | GAL4(1-147)-CREB-S133A | Rattus norvegicus | Ampicillin | PMID:7958915 | Backbone Marker:Invitrogen; Backbone Size:4767; Vector Backbone:pcDNAI-AMP; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | Changed CREB serine 133 to Alanine | 2026-08-15 01:15:35 | 1 | |
|
pcDNAI-GAL4-CREB Resource Report Resource Website 1+ mentions |
RRID:Addgene_46769 | GAL4(1-147)-CREB | Rattus norvegicus | Ampicillin | PMID:7958915 | Backbone Marker:Invitrogen; Backbone Size:4767; Vector Backbone:pcDNAI-AMP; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:15:35 | 1 | ||
|
pKIKOarsBCm Resource Report Resource Website 1+ mentions |
RRID:Addgene_46763 | Chloramphenicol and Ampicillin | PMID:23799955 | This plasmid is used for integration of DNA into the E.coli genome via homologous recombination. The DNA of interest is cloned between arsB homologous arms and integrated at the arsB locus. This plasmid has been found exist in our stock as a multimer. Plasmid multimerization often does not impact plasmid function, but may reduce transformation efficiencies. You may need to screen multiple colonies to isolate the monomeric version of this plasmid. If you still have trouble isolating the monomeric version, you might consider linearizing, gel extracting, re-ligating, and transforming the plasmid. | Backbone Size:3267; Vector Backbone:pKD4; Vector Types:E.coli genomic integration; Bacterial Resistance:Chloramphenicol and Ampicillin | 2026-08-15 01:15:35 | 1 | |||
|
pKIKOlacZCm Resource Report Resource Website 1+ mentions |
RRID:Addgene_46764 | Chloramphenicol and Ampicillin | PMID:23799955 | This plasmid is used for integration of DNA into the E.coli genome via homologous recombination. The DNA of interest is cloned between lacZ homologous arms and integrated at the lacZ locus. | Backbone Size:3267; Vector Backbone:pKD4; Vector Types:E.coli genomic integration; Bacterial Resistance:Chloramphenicol and Ampicillin | 2026-08-15 01:15:35 | 1 | |||
|
pKIKOlacZKm Resource Report Resource Website 1+ mentions |
RRID:Addgene_46767 | Ampicillin and Kanamycin | PMID:23799955 | This plasmid is used for integration of DNA into the E.coli genome via homologous recombination. The DNA of interest is cloned between lacZ homologous arms and integrated at the lacZ locus. | Backbone Size:3267; Vector Backbone:pKD4; Vector Types:E.coli genomic integration; Bacterial Resistance:Ampicillin and Kanamycin | 2026-08-15 01:15:35 | 1 | |||
|
pKIKOrbsARCm Resource Report Resource Website |
RRID:Addgene_46765 | Chloramphenicol and Ampicillin | PMID:23799955 | This plasmid is used for integration of DNA into the E.coli genome via homologous recombination. The DNA of interest is cloned between rbsAR homologous arms and integrated at the rbsAR locus. | Backbone Size:3267; Vector Backbone:pKD4; Vector Types:E.coli genomic integration; Bacterial Resistance:Chloramphenicol and Ampicillin | 2026-08-15 01:15:35 | 0 | |||
|
pKIKOarsBKm Resource Report Resource Website 1+ mentions |
RRID:Addgene_46766 | Ampicillin and Kanamycin | PMID:23799955 | This plasmid is used for integration of DNA into the E.coli genome via homologous recombination. The DNA of interest is cloned between arsB homologous arms and integrated at the arsB locus. | Backbone Size:3267; Vector Backbone:pKD4; Vector Types:E.coli genomic integration; Bacterial Resistance:Ampicillin and Kanamycin | 2026-08-15 01:15:35 | 5 | |||
|
pT7-gRNA Resource Report Resource Website 50+ mentions |
RRID:Addgene_46759 | gRNA core | Synthetic | Ampicillin | PMID:23918387 | For more information on Chen and Wente Lab CRISPR Plasmids please refer to: http://www.addgene.org/crispr/Chen/ | Backbone Size:2400; Vector Backbone:pUC19; Vector Types:CRISPR, zebrafish expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:15:35 | 68 | |
|
pQHA-USP7 WT puroR Resource Report Resource Website 1+ mentions |
RRID:Addgene_46753 | USP7 | Homo sapiens | Ampicillin | PMID:20601937 | Sequence discrepancies between the full and QC sequences have no functional consequence. | Backbone Marker:Clontech; Vector Backbone:pQCXIP; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin | 2026-08-15 01:15:35 | 5 | |
|
pQHA-USP11 CS puroR Resource Report Resource Website 1+ mentions |
RRID:Addgene_46750 | USP11 | Homo sapiens | Ampicillin | PMID:20601937 | Backbone Marker:Clontech; Vector Backbone:pQCXIP; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin | C318S--catalytically inactive | 2026-08-15 01:15:35 | 3 |
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
